AJP - Endo Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 279: E684-E694, 2000;
0193-1849/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, Y.
Right arrow Articles by Baekkeskov, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, Y.
Right arrow Articles by Baekkeskov, S.
Vol. 279, Issue 3, E684-E694, September 2000

Increased expression of GAD65 and GABA in pancreatic beta -cells impairs first-phase insulin secretion

Yuguang Shi1, Jamil Kanaani1, Virginie Menard-Rose1, Yan Hui Ma2, Pi-Yun Chang1, Douglas Hanahan3, Allan Tobin4, Gerold Grodsky2, and Steinunn Baekkeskov1

1 Departments of Medicine, Microbiology and Immunology, and Hormone Research Institute, 2 Department of Biochemistry and Biophysics and Metabolic Research Unit, 3 Department of Biochemistry and Biophysics and Hormone Research Institute, School of Medicine, University of California, San Francisco 94143; and 4 Department of Biology, University of California, Los Angeles, California 90095


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The functional role of glutamate decarboxylase (GAD) and its product GABA in pancreatic islets has remained elusive. Mouse beta -cells express the larger isoform GAD67, whereas human islets express only the smaller isoform GAD65. We have generated two lines of transgenic mice expressing human GAD65 in pancreatic beta -cells (RIP7-hGAD65, Lines 1 and 2) to study the effect that GABA generated by this isoform has on islet cell function. The ascending order of hGAD65 expression and/or activity in beta -cells was Line 1 heterozygotes < Line 2 heterozygotes < Line 1 homozygotes. Line 1 heterozygotes have normal glucose tolerance, whereas Line 1 homozygotes and Line 2 heterozygotes exhibit impaired glucose tolerance and inhibition of insulin secretion in vivo in response to glucose. In addition, fasting levels of blood glucose are elevated and insulin is decreased in Line 1 homozygotes. Pancreas perfusion experiments suggest that GABA generated by GAD65 may function as a negative regulator of first-phase insulin secretion in response to glucose by affecting a step proximal to or at the KATP+ channel.

regulation of insulin secretion; neurotransmitter; pancreas perfusion; glucose intolerance


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

PANCREATIC beta -CELLS in islets of Langerhans express the enzyme glutamate decarboxylase (GAD) and GABA at levels comparable to those encountered in the central nervous system (14, 44, 57). However, the physiological function of these molecules in islets remains unclear (reviewed in 37, 53).

GABA produced in beta -cells has been suggested to serve as a functional regulator of pancreatic hormone release or as a paracrine signaling molecule for communication between beta -cells and the other endocrine cells in islets of Langerhans (53). These hypotheses have been tested by different investigators by use of in vitro assays and exogenous GABA or its mimics. These investigations have yielded conflicting data. In perfused rat and dog pancreas, GABA was shown to inhibit arginine-stimulated insulin release (20, 27). In contrast, perfusion of rat pancreas with GABA or GABA mimics had no detectable effect on insulin secretion (14, 50). Similarly, conflicting results have been reported on the effect of GABA on glucagon and somatostatin secretion (13, 14, 27, 50, 51). There is convincing evidence to suggest that GABA may have an inhibitory effect on glucagon release in vitro (13, 14, 51). It is not clear, however, whether GABA acts as a signal molecule for glucose-induced inhibition of glucagon secretion (14, 51).

There are at least two distinct GABA receptors for inhibitory neurotransmission in the brain, GABAA and GABAB receptors (26, 36). GABAA receptors, which regulate chloride conductance and can cause cell inhibition by hyperpolarization, are expressed on islet alpha - and delta -cells but not on beta -cells (51, 58). It has been proposed that the inhibitory effect of GABA on glucagon secretion may be mediated by GABAA receptors (13, 51). Recent results suggest that GABAB receptors are expressed in pancreatic islets (Chang and Baekkeskov, unpublished results). GABAB receptors are coupled to G proteins and can mediate inhibition of the closure of K+ channels or the opening of Ca2+ channels (26 and references therein). A GABAB receptor agonist has been reported to inhibit both insulin secretion and the rise in cytoplasmic Ca2+ of beta -cells (20).

In mammals, there are two highly homologous nonallelic isoforms of GAD, GAD65 and GAD67 (11). The two forms differ mainly in their association with the co-enzyme pyridoxal 5'-phosphate (PLP) (22, 35) and may differ in some aspects of subcellular targeting (6, 7, 23, 25, 48, 54). GAD65, which is less saturated with co-enzyme (22, 35), is found both in the cytosol and associated with the cytosolic face of the membrane of synaptic-like microvesicles in beta -cells (6, 7, and unpublished results). GAD65 is the major GAD isoform in rat islets and the only isoform in human islets (28, 34, 45). In contrast, mouse beta -cells seem to express exclusively the cytosolic and highly PLP-saturated GAD67 isoform, even though both isoforms were detected at mRNA levels (12, 28, 45-47). Perhaps not surprisingly, therefore, GAD65-/- mice exhibit normal glucose homeostasis (24). Targeted disruption of the GAD67 gene in the mouse is more likely to result in a phenotype because of loss of GABA in islets of Langerhans. Neonatal lethality of GAD67-/- mice has, however, precluded analysis of glucose homeostasis and islet cell function in mice deficient in this isoform (2, 8). Targeted disruption of the genes encoding the GAD isoforms has therefore not provided information about the role of GABA in the endocrine pancreas. Thus the role of GAD and GABA in islets of Langerhans remains elusive.

The experiments reported so far on the effect of GABA on hormone release in pancreatic islets have been limited to analyzing the effect of exogenous GABA and GABA mimics, which may function differently from the endogenous transmitter produced in beta -cells. Thus the physiological conditions that affect GABA synthesis and release may not be approximated by the in vitro assays. Furthermore, the dose of exogenous GABA used in most of the experiments may exceed the level of endogenous GABA (53).

It is not clear how GABA release from beta -cells is regulated in vivo. GABA can be measured in conditioned medium from insulinoma cell lines (13, 40, 55), but not from islets (40), consistent with a paracrine rather than an endocrine function. There are conflicting data as to whether the release from insulinoma cell lines is regulated by glucose (13, 40, 55).

To assess the role of GABA in pancreatic islets in an in vivo setting, we have taken advantage of the low or absent expression of GAD65 in mouse islets and targeted expression of this isoform to beta -cells in two lines of transgenic mice. We show in this study that expression of transgenic GAD65 and elevated levels of GABA in pancreatic beta -cells result in inhibition of glucose-induced insulin release and impaired glucose tolerance and diabetes in transgenic mice. Based on results of studies of the perfused pancreas of transgenic and control mice, we propose that GABA acts as a specific inhibitor of first-phase insulin release and exerts its effect at a step before or at beta -cell depolarization.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Generation of transgenic mice. A 9.7-kb rat insulin promoter sequence (RIP7), including the first intron of the rat insulin II gene (41), was used to direct pancreatic beta -cell specific expression of human GAD65. A transgenic construct (Fig. 1A) was generated by inserting a 1,757-bp BamH I cDNA fragment encoding the human GAD65 into a Cla I site of RIP7 at +180. The RIP7 vector carries polyadenylation sequences from the SV-40 large T antigen gene. To generate cohesive ends for ligation, the BamH I fragment was partially filled with dGTP, dATP, and dTTP, and the Cla I site with dCTP, by use of reverse transcriptase. The transgenic construct, RIP7-hGAD65, was linearized with Sal I and tested for transient expression in a beta TC3 cell line (10) in parallel with transgenic constructs generated by use of shorter versions of the rat insulin promoter, RIP1 and RIP5 (9, 30). The RIP7-hGAD65 construct was shown to mediate the highest expression of GAD65. The distribution of the enzyme between cytosolic and membrane fractions was similar to rat islets (6) (results not shown). Two transgenic founder mice, RIP7-hGAD65 mouse 1 and mouse 2, were generated by microinjection of the RIP7-hGAD65 cDNA at a concentration of ~2 ng/ml into B6D2/F2 mouse embryos, according to established procedures (21). RIP7-hGAD65 mouse 1 and mouse 2 were backcrossed into C57Bl/6 mice. Genetic transmission of the transgene was assessed by Southern blot and by polymerase chain reaction (PCR) analyses with DNA isolated from tail biopsies. Physiological studies were carried out on third- and fourth-generation backcrossed heterozygous 10- to 15-wk-old Line 1 and Line 2 mice. After nine backcrosses into C57Bl/6 mice, Line 1 was bred to homozygosity, and homozygous mice were subjected to physiological studies at 8-15 wk of age. Control mice for all experiments with heterozygote transgenic mice were the transgene-negative littermates of the mice analyzed. Control mice for homozygous Line 1 mice were wild-type C57Bl/6 mice of the same age and sex.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 1.   Generation of transgenic mice and RT-PCR analysis of RIP7-hGAD65 expression. A: rat insulin promoter (RIP7)-human glutamate decarboxylase (hGAD65) hybrid gene, which consists of 9.5 kb of the rat insulin II promoter (RIP7), the first intron of the insulin gene, a cDNA encoding the human GAD65, and a downstream polyadenylation site (Poly A). B: expression analysis at mRNA levels of the RIP7-hGAD65 transgene in heterozygous Line 1 mice, heterozygous Line 2 mice, and transiently transfected beta TC3 cells. RT-PCR analysis was carried out using a DNA template prepared from nontransgenic littermates (mice 1 and 4), transgenic mice from each line (mice 2 and 3 for Line 1; mice 5 and 6 for Line 2), wild-type beta TC3 cells (7), and beta TC3 cells transiently transfected with the RIP7-hGAD65 construct. The DNA templates were prepared with (+) or without (-) reverse transcriptase. Arrows, amplified DNA bands from beta -tubulin and the RIP7-hGAD65 transgene. Lane M shows a DNA band size marker. Similar results were obtained in 2 independent experiments.

PCR analysis of transgenic expression. mRNA expression of the human GAD65 transgene in the transgenic line was analyzed by reverse transcriptase-polymerase chain reaction (RT-PCR) using a 5' primer from the 5' untranslated sequences of RIP7 (AAGTGACCAGCTACAGTCGG) and a 3' primer from the coding region of the human GAD65 gene (AGCAGGTCTGTTGCATGGAG). The tubulin gene was used as a control for the RT-PCR analyses. Total RNAs were isolated from freshly removed mouse pancreases using RNAzol (Tel-Test, Friendswood, TX), followed by digestion with RNase-free DNase I (Promega, Madison, WI) to remove contaminated genomic DNA. PCR amplification conditions were 94°C (2 min), followed by 35 cycles of 94°C (1 min), 60°C (1 min), 72°C (3 min), and finally 72°C for 10 min. The amplified DNA fragments (350 bp) were resolved on a 1.5%-agarose gel.

Immunohistochemical analysis. Immunohistochemical analysis of protein expression of the transgene was performed on frozen sections of mouse pancreas, as previously described (28), using a mixture of three human monoclonal antibodies to GAD65, MICA 2, 4, and 6 (49).

For immunohistochemical analysis of GABA expression, 25 ml of fixative containing 4% paraformaldehyde (Polyscience, PA) and 0.1% glutaraldehyde (Sigma, St. Louis, MO) in PBS, pH 7.3, were perfused directly into the left ventricle of transgenic mice and negative littermates. After perfusion, the pancreas was removed and postfixed in the same fixative for 1 h at 4°C. The tissue was rinsed in 30% sucrose-PBS overnight at 4°C, embedded in Optimal Cutting Temperature (OCT) embedding medium (Tissue Tek, Miles Diagnostic Division, Elkhart, IN), and stored at -80°C. Cryostat sections (20 µm) were fixed in acetone for 15 min, washed in PBS for 15 min, and incubated with 0.2% hydrogen peroxide-PBS for 30 min at room temperature. The sections were blocked with 5% goat serum and 0.2% Triton X-100 in PBS for 30 min at room temperature and incubated overnight at 4°C with rabbit anti-GABA serum (serial dilutions 1:1,000-1:15,000; Incstar, Stillwater, MN) followed by three washes with PBS and incubation with fluorescein-conjugated goat anti-rabbit IgG (1:300; Cappel, Westchester, PA) for 45 min at room temperature. After a wash with PBS, sections were mounted in glycerol-PBS and analyzed by fluorescence microscopy. Staining for insulin was carried out as previously described (28).

Islet isolation and protein expression analysis. Mice were anesthesized with pentobarbital, and the pancreas was inflated with Hanks' balanced salt solution (HBSS; Sigma) before excision. Pancreases were subjected to two sequential incubations of 10 min each with collagenase type XI (Sigma) in a siliconized scintillation vial (2 pancreases per vial) at 37°C under vigorous shaking. The collagenase digest was washed three times in ice-cold HBSS containing 1% BSA (Sigma). Islets were mainly released in the second incubation and were handpicked several times under a stereomicroscope to reach 100% purity. Islets were subjected to a brief recovery period in RPMI 1640 and 10% FCS (GIBCO-BRL, Grand Island, NY), washed in PBS, and snap-frozen on dry ice.

For enzyme, protein, and Western blot assays, islets were extracted at a concentration of 10 islets/µl in 50 mM HEPES-NaOH, pH 7.0, 1 mM 2-aminoethylisothiouronium bromide, 1 mM phenylmethylsulfonyl fluoride, 10 mM benzamidine-HCl, 5 mM sodium fluoride, and 1% Triton X-114. After 1 h of incubation on ice, the lysate was centrifuged at 150,000 g for 1 h to remove cellular debris. For GAD activity assay, the supernatant was aliquoted and diluted in the same buffer without Triton X-114 but containing 0.1% BSA and 10 mM [1-14C]glutamate in the presence and absence of 0.1 mM PLP. Reactions were incubated for 2 h at 37°C and quenched by addition of 6 N HCl (5). Lysis buffer was used as a negative control in the presence and absence of PLP. Protein concentration in the different lysates was determined using the bicinchoninic acid protein assay reagent (Pierce, Rockford, IL) and BSA as standard.

For analysis of GAD expression in islets by immunoblotting, aliquots of the islet lysates were boiled for 3 min in SDS sample buffer (62.5 mM Tris · HCl, pH 6.8, 2% SDS, 2.5% beta -mercaptoethanol, 10% glycerol, and 0.003% bromphenol blue) and then analyzed by SDS-PAGE on 10% polyacrylamide gels. Human GAD65 with a hexahistidine tag was expressed and purified from Escherichia coli (unpublished results) and used as a quantitative standard. Resolved proteins were transferred from gels by Western blotting to Protran BA nitrocellulose transfer membranes (Schleicher and Schuell) and immunostained as described previously (23) with a rabbit antiserum, 1701, which recognizes GAD65 and GAD67 equally well. Furthermore, a GAD67-specific rabbit antiserum, K2 (Chemicon), was used to verify the identity of endogenous GAD67 on Western blots. Antibody staining was visualized using a horseradish peroxidase-coupled secondary antibody and the enhanced chemiluminescence system (Amersham Pharmacia Biotech). For quantitative analysis, images made on Kodak X-Omat film were obtained at various times of exposure, and the amount of GAD65 and GAD67 in the islet lysates was determined from the linear range of a GAD65 standard curve. Scanning of autoradiograms was performed using the DeskScan II program on a Hewlett-Packard ScanJet IIcx, and densitometric analysis was performed using NIH Image software.

Glucose tolerance tests and measurement of insulin and glucagon secretion in vivo. Glucose tolerance tests were conducted in overnight-fasted animals, as previously described (30). Serum insulin levels were measured by radioimmunoassay with a kit (Binax, South Portland, MA) according to the manufacturer's instructions. Serum glucagon levels were measured by a double antibody radioimmunoassay with a kit from Diagnostic Products (Los Angeles, CA) according to the manufacturer's instructions.

Pancreatic perfusion. In vitro pancreas perfusion was performed as previously described for the mouse or Chinese hamster pancreas (17, 30, 32). Perfusate consisted of bicarbonate-phosphate-calcium buffer (17) containing 0.2% purified, "stabilized" bovine albumin and 3% T-40 Dextran (Aldrich Chemical, Milwaukee, WI). Perfusate was introduced into the celiac artery at 1 ml/min, and effluent was collected at 1- to 2-min intervals from the portal vein after a single passage through the pancreas. To minimize loss of soluble oxygen during the transit time from oxygenator to pancreas at these low flow rates (17), glass was employed for the influx tubing. As described (17), perfusate pressure was continuously monitored. Surgical integrity of the system was also evaluated by comparing perfusate inflow rate to efflux rate from the portal vein into the collection tubes. Experiments in which efflux rate was <80% of influx were discarded. As previously described (31), the pancreas was perfused in each experiment for 20 min without glucose to test for nonstimulated leakage or washout of insulin, a potential problem in perfusion experiments using mouse pancreas. This period was also used to establish whether the transgenic mouse pancreas released insulin in a constitutive manner (31). Agents, including glucose, IBMX (Aldrich Chemical), and KCl (Sigma), were added as indicated in the individual experiments. Insulin levels in pancreatic perfusate were measured by solid-phase radioimmunoassay (29), with rat insulin as the reference standard and antiporcine insulin antibody (Linco Research, Eureka, MO). Data analyses were carried out using Student's t-test for paired as well as unpaired values.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Heterozygous RIP7-hGAD65 transgenic mice express elevated levels of GAD65 and GABA, and Line 2 has the highest expression. The RIP7 transgenic vector directs high levels of beta -cell specific expression (41). An RIP7-hGAD65 construct was generated (Fig. 1A) and used for microinjection of mouse embryos. Transgenic RIP7-hGAD65 lines were established from two founder mice identified by Southern blot and PCR analyses. RT-PCR (Fig. 1B), immunohistochemical analysis (Fig. 2, a and b), and immunoblot and enzyme assays (Fig. 3, A and B) established expression of the transgene in Lines 1 and 2. Thus immunofluorescence studies using human GAD65 specific monoclonal antibodies that recognize the mouse and human protein equally well (28) revealed significant expression of GAD65 in islets of both RIP7-hGAD65 Lines 1 and 2 heterozygous mice (Fig. 2, a and b). At the heterozyygote stage, the expression of GAD65 was highest in the RIP7-hGAD65 Line 2 islets. As reported earlier (28), no expression of endogenous GAD65 was detected in normal mouse pancreas by immunofluorescence analysis (results not shown).


View larger version (151K):
[in this window]
[in a new window]
 
Fig. 2.   Immunofluorescence analysis of GAD65 and GABA expression in heterozygous RIP7-hGAD65 transgenic and control mice. a and b: Immunofluorescence micrographs of frozen unfixed sections of RIP7-hGAD65 Line 1 (a) and Line 2 (b) pancreas incubated with a pool of human monoclonal antibodies specific for GAD65 (dilution 1:200), followed by a secondary incubation with an FITC-conjugated monoclonal mouse anti-human IgG antibody (dilution 1:300). Micrographs are representative of results obtained with 4 sets of transgenic and control animals. c and d: Immunofluorescence micrographs of fixed sections of RIP7-hGAD65 Line 2 pancreas (d) and a nontransgenic littermate (c) incubated with a GABA-specific rabbit antibody (dilution 1: 7,500), followed by incubation with an FITC-conjugated goat anti-rabbit IgG. Panels e and f show staining for insulin on sections serial to sections shown in c and d, respectively. For panels c-f, similar results were obtained with 3 sets of transgenic and control animals.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 3.   Expression and GAD enzyme activity in RIP7-hGAD65 transgenic and control mice. A: immunoblot analysis of GAD65 and GAD67 expression in islets of Langerhans. Aliquots of islet cell lysates (20 µg islet cell protein/lane) from C57Bl/6 wild-type mice, RIP7-hGAD65 heterozygous and homozygous Line 1 mice, and heterozygous Line 2 mice were subjected to SDS-PAGE followed by Western blotting and immunostaining with the 1701 antibody that recognizes GAD65 and GAD67 equally well. The identity of the GAD band in wild-type islets as GAD67 was confirmed by staining with an antibody (K2) that is specific for this isoform. GAD67 is also detected as a weak band above the GAD65 band in transgenic mice, and this band was excluded in densitometric analyses of GAD65 expression. The blot is representative of 3 experiments. B: GAD enzyme activity in islets of Langerhans. Enzyme activity was analyzed in islet lysates from C57Bl/6 wild-type mice, RIP7-hGAD65 heterozygous (Hets) and homozygous (Homo) Line 1 mice and heterozygous Line 2 mice in the presence and absence of exogenous pyridoxal 5'-phosphate (PLP). Values are means ± SD (n = 2).

Wild-type mice express GAD67 in pancreatic beta -cells, and GABA generated by this isoform can be detected by immunofluorescence staining (52, 56). To analyze whether transgenic expression of GAD65 resulted in increased levels of GABA in pancreatic beta -cells, pancreatic sections from transgenic and nontransgenic littermates of Line 2 were subjected to incubations with serial dilutions of a GABA antiserum to test whether high dilutions could reveal differences in expression between wild-type and transgenic mice. Dilutions of 1:7,500 and 1:10,000 revealed clear differences in GABA levels between wild-type and transgenic islets (Fig. 2, c and d). At those dilutions, only about one-third of wild-type islets stained for GABA, and the staining was weak (Fig. 2, c). In contrast, 65-75% of transgenic islets were strongly positive for GABA at the same dilutions (Fig. 2, d), and the remainder was moderately or weakly positive. Thus expression of RIP7-hGAD65 results in a significant increase in expression of GAD65 as well as GABA in pancreatic beta -cells.

Line 1 homozygotes express the highest levels of GAD65. After breeding of Line 1 to homozygosity, islets of Langerhans were isolated from Line 1 and Line 2 heterozygotes, from Line 1 homozygous mice, and from wild-type C57Bl/6 mice for analysis of GAD65 expression and activity. Immunoblot analysis was performed using the antibody 1701, which recognizes GAD65 and GAD67 equally well. In some experiments, equal amounts of protein were loaded from transgenic and wild-type islets (Fig. 3A), whereas in other experiments up to a fivefold excess of wild-type islets was loaded on the gel (results not shown). The analyses revealed a high expression of GAD65 in Line 1 and Line 2 transgenic mice, which was severalfold higher than expression of endogenous GAD67 in wild-type and transgenic mice (Fig. 3A). Overloading of protein and prolonged exposures of autoradiograms did not reveal expression of endogenous GAD65 in islets of wild-type mice (results not shown). Quantitative immunoblot analysis (a representative blot is shown in Fig. 3A) revealed that expression of GAD65 was highest in Line 1 homozygous mice, followed by Line 2 heterozygotes and then Line 1 heterozygotes. The levels of transgenic GAD65 exceeded endogenous GAD67 levels by ~8.7-fold (Line 1 homozygotes), 7.5-fold (Line 2 heterozygotes), and 4.5-fold (Line 1 heterozygotes). Thus Line 1 homozygotes, Line 2 heterozygotes, and Line 1 heterozygotes represent three distinct levels of GAD65 expression.

We next analyzed GAD enzyme activity in isolated islets from Line 1 heterozygotes, Line 2 heterozygotes, Line 1 homozygotes, and wild-type C57Bl/6 mice to confirm that the increased expression levels in transgenic mice also reflect increased enzyme activity in islets, and therefore a potential for GABA production. GAD65 provides the majority of PLP-inducible apoenzyme activity in brain but is also present as a holoenzyme (35). Enzyme analysis in the presence and absence of exogenous PLP revealed no PLP-inducible enzyme activity in wild-type C57Bl/6 mice, consistent with the absence of GAD65 in normal mouse islets. Approximately 1.6-fold and 3.4-fold increases in holoenzyme activity over wild-type mice were observed in Line 2 heterozygotes and in Line 1 homozygotes, respectively, whereas no increase was detected in Line 1 heterozygotes (Fig. 3B). Addition of PLP resulted in ~7-fold, 11-fold, and 15-fold increases in GAD activity in Line 1 heterozygotes, Line 2 heterozygotes, and Line 1 homozygotes, respectively. Thus transgenic GAD65 contributes to holoenzyme activity in the two highest expressing lines but most significantly enhances the apoenzyme pool in all three lines.

Exhibition of impaired glucose tolerance and elevated blood sugars in vivo in RIP7-hGAD65 transgenic mice. We addressed the question of whether increased levels of GAD65 and GABA affect glucose homeostasis. Blood glucose levels were analyzed in transgenic mice after an overnight fast and at different time points after glucose administration (Fig. 4). Fasting blood glucose levels in transgenic and control mice were not significantly different for Line 2 heterozygotes (Fig. 4B) or in Line 1 heterozygotes (not shown). However, they were significantly elevated in Line 1 homozygotes (Fig. 4A). Analyses of blood glucose levels after intraperitoneal administration of glucose revealed impaired glucose tolerance in Line 1 homozygotes and in Line 2 heterozygotes (Fig. 4), whereas Line 1 heterozygotes remained normal (results not shown). Blood glucose levels maximized at 20 min in control mice and approached basal values by 90 min. In contrast, Line 1 homozygotes and Line 2 heterozygotes showed prolonged high blood glucose levels. Whereas Line 2 mice reached normal blood glucose levels at 150 min, glucose levels in Line 1 were still elevated at 180 min (Fig. 4). Thus impairment of glucose tolerance is most severe in Line 1 homozygotes, which express the highest levels of antigen, and these mice also exhibit elevated fasting blood sugar.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Elevated fasting blood sugar and/or impaired glucose tolerance in RIP7-hGAD65 transgenic mice. Homozygous Line 1 mice, heterozygous Line 2 mice, and control animals were fasted overnight before receiving an ip injection of 2 mg glucose/g body wt. Blood samples were obtained from tail biopsies of each animal before administration of glucose (t = 0) and after glucose administration at the times indicated. Glucose was determined with a glucose meter. Values are means ± SE for 12 transgenic homozygous Line 1 mice and 12 C57Bl/6 controls of the same age and sex (A) and for 5 transgenic or 5 nontransgenic littermates of the same sex and age for Line 2 (B). * P < 0.05; ** P < 0.01.

Exhibition of decreased insulin secretion in vivo in transgenic mice. To assess whether the hyperglycemia in homologous Line 1 mice and heterologous Line 2 mice was associated with abnormal secretion of islet hormones, serum insulin and glucagon levels were monitored in separate glucose stimulation experiments. No significant differences were found in serum glucagon levels between the transgenic and control mice (data not shown). As shown in Fig. 5A, fasting serum insulin levels were significantly lower in Line 1 homozygotes [0.33 ± 0.02 (SD) ng/ml] compared with control C57Bl/6 mice of the same age and sex (0.42 ± 0.02 ng/ml; P < 0.01) and remained significantly lower after administration of glucose. The increment over basal in Line 1 homozygous mice was also significantly different between transgenic and control animals at both 30 min [0.11 ± 0.07 (SD) vs. 0.55 ± 0.14; P < 0.001] and 90 min (0.12 ± 0.07 vs. 0.87 ± 0.08; P < 0.001). Although there was a tendency for lower fasting serum insulin levels in Line 2 heterozygotes compared with nontransgenic littermates, the differences were not statistically significant either in the set of animals shown in Fig. 5B or in a set of 10 transgenic and 10 control animals subsequently analyzed. The combined data for basal insulin levels obtained for 15 transgenic Line 2 mice and 15 nontransgenic littermates of the same sex and age were 0.20 ± 0.10 (SD) ng/ml for transgenic mice vs. 0.26 ± 0.17 ng/ml for control mice (P < 0.15). Administration of glucose, however, elicited significantly lower blood insulin levels in Line 2 mice at both 30 and 90 min (Fig. 5B). The increment above basal in Line 2 heterozygotes was also significantly different between transgenic and control animals, at both 30 min: 0.15 ± 0.15 (transgenic) vs. 0.47 ± 0.18 ng/ml (controls) (P < 0.025) and at 90 min: 0.31 ± 0.22 (transgenic) vs. 0.84 ± 0.19 ng/ml (controls) (P < 0.001). These results suggest that the fasting hyperglycemia observed in Line 1 homozygotes and the hyperglycemia measured during a glucose tolerance test in both lines are caused by a decrease in glucose-induced insulin secretion.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5.   Decreased fasting blood insulin and/or secreted blood insulin levels in response to glucose in RIP7-hGAD65 transgenic mice. Homozygous Line 1 (A), heterozygous Line 2 (B), and control mice were fasted overnight. Blood samples were collected after overnight fast and at 30 and 90 min after glucose administration and were analyzed for insulin content. Values are means ± SE for 5 transgenic and 5 control mice for each line. * P < 0.05; ** P < 0.01.

GAD65 is an important target of autoimmunity in type 1 diabetes in humans (3) and in the nonobese diabetic mouse (59). We speculated that increased expression of GAD65 could target beta -cells for infiltration by mononuclear lymphocytes and autoimmune destruction. However, hematoxylin-eosin staining (results not shown) and immunostaining for insulin in pancreatic sections from RIP7-hGAD65 Line 1 (results not shown) and Line 2 mice (Fig. 2, compare panels e and f) at different ages revealed no insulitis and no loss of beta -cells. Thus the decrease in insulin secretion and abnormal glucose tolerance in transgenic mice are not the result of autoimmune processes and pancreatic beta -cell destruction.

RIP7-hGAD65 Line 2 mice exhibit a selective inhibition of first-phase insulin secretion in vitro. To identify the nature of the inhibition of insulin secretion in transgenic mice, the kinetics of insulin secretion during stimulation with glucose and IBMX were examined using in vitro pancreas perfusion of Line 2 heterozygotes. An initial perfusion without glucose (31) showed no evidence of leakage or constitutive release of insulin. Glucose at 7 mM was selected for the first stimulatory step, because it approximates the basal glucose levels in those mice (Fig. 6). It also is the level at which a submaximal first-phase insulin release is consistently detected (15) and can be used to assess either enhancement or impairment of insulin secretion. This concentration of glucose elicited a sharp first-phase insulin secretion from control pancreases (Fig. 6), as previously reported (32). In contrast, the first-phase insulin response of transgenic pancreases was significantly lowered (17.38 ± 4.22 vs. 45.6 ± 5.07 ng/ml in nontransgenic littermates; Fig. 6). Only a single time point at 38 min was significantly suppressed during second-phase release in transgenic mice. The perfused pancreas of both transgenic and control mice responded to subsequent ascending levels of 11 and 22 mM glucose. The declining insulin responses to higher glucose steps observed for both transgenic and control mice (Fig. 6) have been previously shown (15, 30) and were ascribed to a packet storage of insulin with differing sensitivities to glucose, or alternatively to feedback inhibition (43), also termed time-dependent inhibition (42). In the presence of 22 mM glucose, IBMX, an inhibitor of cAMP phosphodiesterase, potentiated the response to glucose with a large and rapid increase in insulin secretion that was identical in transgenic and control pancreases (Fig. 6). Hence, inhibition of glucose-induced insulin secretion in RIP7-hGAD65 Line 2 heterozygous mice primarily affects the first phase of insulin secretion in response to physiological levels of glucose. The single time point that was significantly suppressed during second-phase release could indicate an additional minor effect on this phase.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6.   The first phase of glucose-stimulated insulin secretion is impaired in RIP7-hGAD65 Line 2 mice. Pancreases from RIP7-hGAD65 Line 2 mice and nontransgenic littermates were perfused for 20 min with perfusate alone to flush residual hormones, followed by perfusion for 20 min for each of step gradients containing 7 mM, 11 mM, and 22 mM glucose, and 22 mM glucose plus 0.2 mM IBMX as indicated. Pancreas perfusate was collected in 2-min fractions and analyzed for insulin content. Values are means ± SE for 5 transgenic mice and 5 nontransgenic littermates. * P < 0.05; ** P < 0.01.

A defect before membrane depolarization of the pancreatic beta -cell. Insulin secretion in response to glucose involves coordinated steps, including 1) elevation of intracellular ATP levels as a result of glucose metabolism; 2) closure of sulfonylurea-sensitive KATP+ channels, and beta -cell depolarization; 3) activation of Ca2+ channels, and oscillation of cytoplasmic Ca2+ levels; and 4) induction of exocytosis (1, 39). To assess whether the defect in first-phase insulin secretion in transgenic mice is at a step before or after depolarization of the beta -cell, K+ was used to artificially depolarize the beta -cell and bypass the closure of KATP+ channels in Line 2 heterozygotes. It has been shown that stimulation of the pancreas with depolarizing concentrations of K+ alone primarily results in first-phase insulin secretion (16). In such experiments, glucose has an additive potentiating effect on insulin release (18). Because we had found the response to glucose to be atypical (Fig. 4), glucose was excluded in the experiments with K+ to eliminate it as a variable and to allow a direct measurement of the effect of depolarization on insulin release in the transgenic and the normal pancreas. K+ at 20 mM stimulated a sharp first-phase insulin response and a low prolonged insulin secretion that were identical in transgenic and control mice (Fig. 7). A subsequent stimulation with physiological glucose (7 mM) at 50 min again revealed a similar defective first-phase insulin response in transgenic mice, much as when glucose was used as the initial stimulus (compare Fig. 7 with Fig. 6). Thus, in the same pancreas, both the normal response to K+ and the impaired response to glucose are demonstrable.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of depolarization on insulin secretion in RIP7-hGAD65 mice. Pancreases from RIP7-hGAD65 Line 2 mice or nontransgenic littermates were perfused for 15 min at each step with perfusate buffer alone, buffer containing 20 mM KCl, buffer alone, and finally buffer containing 7 mM glucose. Values are means ± SE for 4 transgenic mice and 4 nontransgenic littermates. Bypassing the depolarization step restores first-phase insulin secretion in RIP7-hGAD65 mice.

The results show that the beta -cell secretory machinery, distal to the beta -cell depolarization step, is normal in transgenic mice, suggesting that the defect in first-phase insulin secretion is at a step either before or involving the KATP+ channel itself.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study, we show that expression of the smaller isoform of the GABA synthesizing enzyme GAD in pancreatic beta -cells of RIP7-hGAD65 transgenic mice results in elevated GAD enzyme activity and increased GABA levels in beta -cells. Line 1 heterozygotes, which have the lowest expression of transgenic GAD65, do not display a phenotype. However, homozygous mice of this line, which express almost twice the levels of the enzyme, have the most severe phenotype and exhibit elevated fasting blood glucose, impaired glucose tolerance, and inhibition of fasting as well as glucose-induced insulin secretion. Line 2 heterozygotes, which express ~1.6-fold the levels of Line 1 heterozygotes, have a more subtle phenotype, which includes impaired glucose tolerance, inhibition of insulin secretion in response to glucose, but normal fasting blood glucose and insulin levels. Thus increasing levels of GAD65 expression in the transgenic lines correlate with severity of the phenotype. Line 2 heterozygotes do not develop chronic hyperglycemia, diabetes, or obesity over a lifespan of 2.5 yr (not shown). Line 1 homozygous mice are currently being monitored over a prolonged period to assess these parameters.

Our in vitro studies, using the perfused pancreas in Line 2 heterozygotes, suggest that an inhibition of insulin secretion occurs primarily at the first phase of insulin release stimulated at physiological glucose levels. A single time point, however, was significantly suppressed during second-phase release. Thus the inhibitory effect may not be strictly limited to the first phase of insulin secretion. These results are clearly distinct from a more general inhibition of the insulin secretory pathway seen in perfusion studies of some transgenic models, which overexpress membrane proteins in pancreatic beta -cells (19). The normal potentiating effect of IBMX in RIP7-hGAD65 mice suggests that the inhibition of first-phase insulin secretion does not involve cAMP-mediated signaling pathways.

Whereas the in vivo analysis of RIP7-hGAD65 Line 2 mice showed a consistently impaired insulin release at all glucose levels during glucose challenge, the in vitro pancreas perfusion analysis detected impairment only at the first step of glucose stimulation (7 mM) but not at subsequent steps of 11 mM and 22 mM glucose. It is possible that, in vitro, the inhibitory effect of the elevated GABA levels is obscured by the nature of stepwise increments in glucose concentration and the lack of feedback mechanisms by circulating inhibitors and potentiators (15, 42, 43).

It was shown previously that stimulation of the pancreas with depolarizing concentrations of K+ in the absence of glucose causes mainly first-phase insulin secretion (16). In the present study, we found that the response to K+ in the transgenic pancreas is normal. These results indicate that the beta -cell machinery distal to beta -cell depolarization, including Ca2+ channels and exocytosis of secretory vesicles, is intact in RIP7-hGAD65 transgenic mice. Thus inhibition of first-phase insulin secretion probably results from events occurring before membrane depolarization, in the glucose metabolic cascade, or at the K+ ATP channel (1, 39).

How does GAD65/GABA expressed in beta -cells exert an inhibitory effect on first-phase insulin secretion? At least two possible mechanisms can be proposed. First, recent evidence suggests that glutamate may act as a messenger that enters secretory vesicles and induces their priming to become part of a readily releasable pool of granules (33). The levels of GAD65 in RIP7-hGAD65 Line 2 islets are similar to the endogenous levels of the protein in rat and human islets, in which the protein is still relatively rare (4). It is possible, however, that transgenic GAD65 significantly affects levels of glutamate (substrate), resulting in an inhibition of priming. Such inhibition would, however, be predicted to affect mainly second-phase insulin release, which is inconsistent with the observations in RIP7-hGAD65 mice. The second possibility is that the phenotype of RIP7-hGAD65 mice is mediated by the elevated levels of GABA synthesized by GAD65. Metabolism of GABA in the tricarboxylic acid cycle via the GABA shunt (38) seems to be excluded, because this process is likely to generate ATP and stimulate insulin secretion. Alternatively, GABA accumulated in vesicles and secreted from the beta -cell may mediate a paracrine or autocrine inhibitory effect on insulin secretion via GABA receptors. GABAA receptors are expressed on alpha - or delta -cells (51), and GABAB receptors are expressed on beta -cells (Chang and Baekkeskov, unpublished results). One hypothesis is that GABA secreted by beta -cells inhibits first-phase insulin secretion in an autocrine fashion via G protein-linked GABAB receptors.

Earlier studies, using exogenous GABA, have reported a wide variety of effects on beta -cell function, including a general inhibition of both phases of insulin secretion, a stimulation of insulin secretion, or no effect at all (37, 53 for review). The inherent contradiction of the studies using exogenous GABA is not understood, but it may involve differences in GABA uptake and/or transport in the different experimental systems. Our results, with a transgenic model, which increases GAD65 and GABA levels in beta -cells, suggest that the action of the endogenous transmitter synthesized in these cells is primarily, although perhaps not exclusively, to regulate the first phase of insulin secretion elicited by glucose at step(s) proximal to or at the KATP+ channel.


    ACKNOWLEDGEMENTS

We thank John Kim, Ann Neill, Raquel Nagal, and Mary Ann Jones for excellent technical assistance, and Patti Keefe for help with references.


    FOOTNOTES

This study was supported by National Institutes of Health Grants R01 DK-47043 (to S. Baekkeskov) and P01 DK-41822 (to S. Baekkeskov and D. Hanahan), the Nora Eccles Treadwell Foundation (to S. Baekkeskov), an American Diabetes Association Mentor-Based Fellowship (to S. Baekkeskov), and a Fellowship Award from the Juvenile Diabetes Foundation International (to Y. Shi).

Present address of Y. Shi: Diabetes Research, Endocrine Division, Lilly Research Laboratories, Eli Lilly and Co., Indianapolis, IN 46285.

Address for reprint requests and other correspondence: S. Baekkeskov, Hormone Research Institute, Univ. of California San Francisco, 513 Parnassus Ave., Rm. HSW 1090, San Francisco, CA 94143-0534 (E-mail: s_baekkeskov{at}biochem.ucsf.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Received 5 August 1999; accepted in final form 25 April 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Aguilar-Bryan, L, and Bryan J. Molecular biology of adenosine triphosphate-sensitive potassium channels. Endocrine Rev 20: 101-135, 1999[Abstract/Free Full Text].

2.   Asada, H, Kawamura Y, Maruyama K, Kume H, Ding RG, Kanbara N, Kuzume H, Sanbo M, Yagi T, and Obata K. Cleft palate and decreased brain gamma-aminobutyric acid in mice lacking the 67-kDa isoform of glutamic acid decarboxylase. Proc Natl Acad Sci USA 94: 6496-6499, 1997[Abstract/Free Full Text].

3.   Bækkeskov, S, Aanstoot HJ, Christgau S, Reetz A, Solimena M, Cascalho M, Folli F, Richter-Olesen H, and De-Camilli P. Identification of the 64K autoantigen in insulin dependant diabetes as the GABA-synthesising enzyme glutamic acid decarboxylase. Nature 347: 151-156, 1990[Medline].

4.   Baekkeskov, S, Warnock G, Christie M, Rajotte RV, Larsen PM, and Fey S. Revelation of specificity of 64K autoantibodies in IDDM serums by high-resolution 2-D gel electrophoresis. Unambiguous identification of 64K target antigen. Diabetes 38: 1133-1141, 1989[Abstract].

5.   Blindermann, JM, Maitre M, Ossola L, and Mandel P. Purification and some properties of L-glutamate decarboxylase from human brain. Eur J Biochem 86: 143-152, 1978[Web of Science][Medline].

6.   Christgau, S, Aanstoot HJ, Schierbeck H, Begley K, Tullin S, Hejnaes H, and Baekkeskov S. Membrane anchoring of the autoantigen GAD65 to microvesicles in pancreatic beta -cells by palmitoylation in the N-terminal domain. J Cell Biol 118: 309-320, 1992[Abstract/Free Full Text].

7.   Christgau, S, Schierbeck H, Aanstoot HJ, Aagaard L, Begley K, Kofod H, Hejnaes K, and Baekkeskov S. Pancreatic beta -cells express two autoantigenic forms of glutamic acid decarboxylase, a 65kDa hydrophilic form and a 64kDa amphiphilic form which can be both membrane-bound and soluble. J Biol Chem 266: 21257-21264, 1991[Abstract/Free Full Text].

8.   Condie, BG, Bain G, Gottlieb DI, and Capecchi MR. Cleft palate in mice with a targeted mutation in the gamma-aminobutyric acid-producing enzyme glutamic acid decarboxylase 67. Proc Natl Acad Sci USA 94: 11451-11455, 1997[Abstract/Free Full Text].

9.   Edwards, RH, Rutter WJ, and Hanahan D. Directed expression of NGF to pancreatic beta cells in transgenic mice leads to selective hyperinnervation of the islets. Cell 58: 161-170, 1989[Web of Science][Medline].

10.   Efrat, S, Linde S, Kofod H, Spector D, Delannoy M, Grant S, Hanahan D, and Baekkeskov S. Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene. Proc Natl Acad Sci USA 85: 9037-9041, 1988[Abstract/Free Full Text].

11.   Erlander, MG, Tillakaratne NJ, Feldblum S, Patel N, and Tobin AJ. Two genes encode distinct glutamate decarboxylases. Neuron 7: 91-100, 1991[Web of Science][Medline].

12.   Faulkner-Jones, BE, Cram DS, Kun J, and Harrison LC. Localization and quantitation of expression of two glutamate decarboxylase genes in pancreatic beta-cells and other peripheral tissues of mouse and rat. Endocrinology 133: 2962-2972, 1993[Abstract/Free Full Text].

13.   Gaskins, HR, Baldeon ME, Selassie L, and Beverly JL. Glucose modulates gamma-aminobutyric acid release from the pancreatic beta TC6 cell line. J Biol Chem 270: 30286-30289, 1995[Abstract/Free Full Text].

14.   Gilon, P, Bertrand G, Loubatieres-Mariani MM, Remacle C, and Henquin JC. The influence of gamma-aminobutyric acid on hormone release by the mouse and rat endocrine pancreas. Endocrinology 129: 2521-2529, 1991[Abstract/Free Full Text].

15.   Grodsky, GM. A threshold distribution hypothesis for packet storage of insulin and its mathematical modeling. J Clin Invest 51: 2047-2059, 1972.

16.   Grodsky, GM, Epstein GH, Fanska R, and Karam JH. Pancreatic action of the sulfonylureas. Federation Proc 36: 2714-2719, 1977[Web of Science][Medline].

17.   Grodsky, GM, and Heldt A. Method for the in vitro perfusion of the pancreas. In: Methods in Diabetes Research, edited by Larner J, and Pohl SL. New York: Wiley, 1984, p. 117-146.

18.   Grodsky, GM, Lee JC, and Licko V. Characteristics of multiphasic insulin release in vitro. Proc Congr Int Diabetes Fed VII 231: 427-442, 1971. (Exerpta Medica Fndn Series)

19.   Grodsky, GM, Ma YH, Cullen B, and Sarvetnick N. Effect on insulin production sorting and secretion by major histocompatibility complex class II gene expression in the pancreatic beta-cell of transgenic mice. Endocrinology 131: 933-938, 1992[Abstract/Free Full Text].

20.   Gu, XH, Kurose T, Kato S, Masuda K, Tsuda K, Ishida H, and Seino Y. Suppressive effect of GABA on insulin secretion from the pancreatic beta-cells in the rat. Life Sci 52: 687-694, 1993[Web of Science][Medline].

21.   Hogan, B, Costantini F, and Lacy E. Anipulating the Mouse Embryo. Plainview, NY: Cold Spring Harbor Laboratory Press, 1986.

22.   Itoh, M, and Uchimura H. Regional differences in cofactor saturation of glutamate decarboxylase (GAD) in discrete brain nuclei of the rat. Effect of repeated administration of haloperidol on GAD activity in sumstantia nigra. Neurochem Res 6: 1283-1289, 1981[Web of Science][Medline].

23.   Kanaani, J, Lissin D, Kash SF, and Baekkeskov S. The hydrophilic isoform of glutamate decarboxylase, GAD67, is targeted to membranes and nerve terminals independent of dimerization with the hydrophobic membrane-anchored isoform, GAD65. J Biol Chem 274: 37200-37209, 1999[Abstract/Free Full Text].

24.   Kash, SF, Johnson RS, Tecott LH, Noebels JL, Mayfield RD, Hanahan D, and Baekkeskov S. Epilepsy in mice deficient in the 65-kDa isoform of glutamic acid decarboxylase. Proc Natl Acad Sci USA 94: 14060-14065, 1997[Abstract/Free Full Text].

25.   Kaufman, DL, Houser CR, and Tobin AJ. Two forms of the gamma -aminobutyric acid synthetic enzyme glutamate decarboxylase have distinct intraneuronal distributions and cofactor interactions. J Neurochem 56: 720-723, 1991[Web of Science][Medline].

26.   Kaupmann, K, Huggel K, Heid J, Flor PJ, Bischoff S, Mickel SJ, McMaster G, Angst C, Bittiger H, Froestl W, and Bettler B. Expression cloning of GABA(B) receptors uncovers similarity to metabotropic glutamate receptors. Nature 386: 239-246, 1997[Medline].

27.   Kawai, K, and Unger RH. Effects of gamma-aminobutyric acid on insulin, glucagon, and somatostatin release from isolated perfused dog pancreas. Endocrinology 113: 111-113, 1983[Abstract/Free Full Text].

28.   Kim, J, Richter W, Aanstoot HJ, Shi Y, Fu Q, Rajotte R, Warnock G, and Baekkeskov S. Differential expression of GAD65 and GAD67 in human, rat, and mouse pancreatic islets. Diabetes 42: 1799-1808, 1993[Abstract].

29.   Levin, SR, Grodsky GM, Hagura R, and Smith D. Comparison of the inhibitory effects of diphenylhydantoin and diazoxide upon insulin secretion from the isolated perfused pancreas. Diabetes 21: 856-862, 1972[Web of Science][Medline].

30.   Ma, YH, Landis C, Tchao N, Wang J, Rodd G, Hanahan D, Bourne HR, and Grodsky GM. Constitutively active stimulatory G-protein alpha s in beta-cells of transgenic mice causes counterregulation of the increased adenosine 3',5'-monophosphate and insulin secretion. Endocrinology 134: 42-47, 1994[Abstract/Free Full Text].

31.   Ma, YH, Lores P, Wang J, Jami J, and Grodsky GM. Constitutive (pro)insulin release from pancreas of transgenic mice expressing monomeric insulin. Endocrinology 136: 2622-2630, 1995[Abstract].

32.   Ma, YH, Wang J, Rodd GG, Bolaffi JL, and Grodsky GM. Differences in insulin secretion between the rat and mouse: role of cAMP. Eur J Endocrinol 132: 370-376, 1995[Abstract/Free Full Text].

33.   Maechler, P, and Wollheim CB. Mitochondrial glutamate acts as a messenger in glucose-induced insulin exocytosis. Nature 402: 685-689, 1999[Medline].

34.   Mally, MI, Cirulli V, Otonkoski T, Soto G, and Hayek A. Ontogeny and tissue distribution of human GAD expression. Diabetes 45: 496-501, 1996[Abstract].

35.   Martin, DL, Martin SB, Wu SJ, and Espina N. Regulatory properties of brain glutamate decarboxylase (GAD): the apoenzyme of GAD is present principally as the smaller of two molecular forms of GAD in brain. J Neurosci 11: 2725-2731, 1991[Abstract].

36.   Mehta, AK, and Ticku MK. An update on GABAA receptors. Brain Res Brain Res Rev 29: 196-217, 1999[Medline].

37.   Michalik, M, and Erecinska M. GABA in pancreatic islets: metabolism and function. Biochem Pharmacol 44: 1-9, 1992[Web of Science][Medline].

38.   Michalik, M, Nelson J, and Erecinska M. GABA production in rat islets of Langerhans. Diabetes 42: 1506-1513, 1993[Abstract].

39.   Miki, T, Nagashima K, and Seino S. The structure and function of the ATP-sensitive K+ channel in insulin-secreting pancreatic beta-cells. J Mol Endocrinol 22: 113-123, 1999[Abstract].

40.   Nagamatsu, S, Watanabe T, Nakamichi Y, Yamamura C, Tsuzuki K, and Matsushima S. Alpha-soluble N-ethylmaleimide-sensitive factor attachment protein is expressed in pancreatic beta cells and functions in insulin but not gamma-aminobutyric acid secretion. J Biol Chem 274: 8053-8060, 1999[Abstract/Free Full Text].

41.   Naik, P, Karrim J, and Hanahan D. The rise and fall of apoptosis during multistage tumorigenesis: down-modulation contributes to tumor progression from angiogenic progenitors. Genes Dev 10: 2105-2116, 1996[Abstract/Free Full Text].

42.   Nesher, R, and Cerasi E. Biphasic insulin release as the expression of combined inhibitory and potentiating effects of glucose. Endocrinology 121: 1017-1024, 1987[Abstract/Free Full Text].

43.   O'Connor, MD, Landahl H, and Grodsky GM. Comparison of storage- and signal-limited models of pancreatic insulin secretion. Am J Physiol Regulatory Integrative Comp Physiol 238: R378-R389, 1980.

44.   Okada, Y, Taniguchi H, and Schimada C. High concentration of GABA and high glutamate decarboxylase activity in rat pancreatic islets and human insulinoma. Science 194: 620-622, 1976[Abstract/Free Full Text].

45.   Petersen, JS, Russel S, Marshall MO, Kofod H, Buschard K, Cambon N, Karlsen AE, Boel E, Hagopian WA, Hejnaes KR, Moody A, Dyrberg T, and Lernmark Å, Madsen OD, and Michelsen BK. Differential expression of glutamic acid decarboxylase in rat and human islets. Diabetes 42: 484-495, 1993[Abstract].

46.   Pleau, JM, Esling A, Bach JF, and Dardenne M. Gene expression of pancreatic glutamic acid decarboxylase in the nonobese diabetic mouse. Biochem Biophys Res Commun 220: 399-404, 1996[Web of Science][Medline].

47.   Pleau, JM, Throsby M, Esling A, and Dardenne M. Ontogeny of glutamic acid decarboxylase gene expression in the mouse pancreas. Biochem Biophys Res Commun 233: 227-230, 1997[Web of Science][Medline].

48.   Reetz, A, Solimena M, Matteoli M, Folli F, Takei K, and DeCamilli P. GABA and pancreatic beta -cells: colocalization of glutamic acid decarboxylase (GAD) and GABA with synaptic like microvesicles suggests their role in GABA storage and secretion. EMBO J 10: 1275-1284, 1991[Web of Science][Medline].

49.   Richter, W, Shi Y, and Baekkeskov S. Autoreactive epitopes in glutamic acid decarboxylase defined by diabetes-associated human monoclonal antibodies. Proc Natl Acad Sci USA 90: 2832-2836, 1993[Abstract/Free Full Text].

50.   Robbins, MS, Grouse LH, Sorenson RL, and Elde RP. Effect of muscimol on glucose-stimulated somatostatin and insulin release from the isolated, perfused rat pancreas. Diabetes 30: 168-171, 1981[Abstract].

51.   Rorsman, P, Berggren PO, Bokvist K, Ericson H, Mohler H, Ostenson CG, and Smith PA. Glucose-inhibition of glucagon secretion involves activation of GABA(A)-receptor chloride channels. Nature 341: 233-236, 1989[Medline].

52.   Saravia-Fernandez, F, Faveeuw C, Blasquez-Bulant C, Tappaz M, Throsby M, Pelletier G, Vaudry H, Dardenne M, and Homo-Delarche F. Localization of gamma-aminobutyric acid and glutamic acid decarboxylase in the pancreas of the nonobese diabetic mouse. Endocrinology 137: 3497-3506, 1996[Abstract].

53.   Satin, LS, and Kinard TA. Neurotransmitters and their receptors in the islets of Langerhans of the pancreas: what messages do acetylcholine, glutamate, and GABA transmit? Endocrine 8: 213-223, 1998[Web of Science][Medline].

54.   Shi, Y, Veit B, and Baekkeskov S. Amino acid residues 24-31 but not palmitoylation of cysteines 30 and 45 are required for membrane anchoring of glutamic acid decarboxylase, GAD65. J Cell Biol 124: 927-934, 1994[Abstract/Free Full Text].

55.   Smismans, A, Schuit F, and Pipeleers D. Nutrient regulation of gamma-aminobutyric acid release from islet beta cells. Diabetologia 40: 1411-1415, 1997[Web of Science][Medline].

56.   Sorenson, RL, Garry DG, and Brelje TC. Structural and functional considerations of GABA in islets of Langerhans. Beta-cells and nerves. Diabetes 40: 1365-1374, 1991[Abstract].

57.   Taniguchi, H, Okada Y, Seguchi H, Shimada C, Seki M, Tsutou A, and Baba S. High concentration of gamma-aminobutyric acid in pancreatic beta cells. Diabetes 28: 629-633, 1979[Abstract].

58.   Yang, W, Reyes AA, and Lan NC. Identification of the GABAA receptor subtype mRNA in human pancreatic tissue. FEBS Lett 346: 257-262, 1994[Web of Science][Medline].

59.   Yoon, JW, Yoon CS, Lim HW, Huang QQ, Kang Y, Pyun KH, Hirasawa K, Sherwin RS, and Jun HS. Control of autoimmune diabetes in NOD mice by GAD expression or suppression in beta cells. Science 284: 1183-1187, 1999[Abstract/Free Full Text].


Am J Physiol Endocrinol Metab 279(3):E684-E694
0193-1849/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Casimir, F. M. Lasorsa, B. Rubi, D. Caille, F. Palmieri, P. Meda, and P. Maechler
Mitochondrial Glutamate Carrier GC1 as a Newly Identified Player in the Control of Glucose-stimulated Insulin Secretion
J. Biol. Chem., September 11, 2009; 284(37): 25004 - 25014.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. M. Bonaventura, P. N. Catalano, A. Chamson-Reig, E. Arany, D. Hill, B. Bettler, F. Saravia, C. Libertun, and V. A. Lux-Lantos
GABAB receptors and glucose homeostasis: evaluation in GABAB receptor knockout mice
Am J Physiol Endocrinol Metab, January 1, 2008; 294(1): E157 - E167.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. Wang, R. Mao, M. Van De Casteele, D. Pipeleers, and Z. Ling
Glucagon-like peptide-1 stimulates GABA formation by pancreatic beta-cells at the level of glutamate decarboxylase
Am J Physiol Endocrinol Metab, April 1, 2007; 292(4): E1201 - E1206.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. Wendt, B. Birnir, K. Buschard, J. Gromada, A. Salehi, S. Sewing, P. Rorsman, and M. Braun
Glucose Inhibition of Glucagon Secretion From Rat {alpha}-Cells Is Mediated by GABA Released From Neighboring {beta}-Cells
Diabetes, April 1, 2004; 53(4): 1038 - 1045.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
M. Braun, A. Wendt, B. Birnir, J. Broman, L. Eliasson, J. Galvanovskis, J. Gromada, H. Mulder, and P. Rorsman
Regulated Exocytosis of GABA-containing Synaptic-like Microvesicles in Pancreatic {beta}-cells
J. Gen. Physiol., February 23, 2004; 123(3): 191 - 204.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
I. K. Franklin and C. B. Wollheim
GABA in the Endocrine Pancreas: Its Putative Role as an Islet Cell Paracrine-signalling Molecule
J. Gen. Physiol., February 23, 2004; 123(3): 185 - 190.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Bertrand, N. Ishiyama, M. Nenquin, M. A. Ravier, and J.-C. Henquin
The Elevation of Glutamate Content and the Amplification of Insulin Secretion in Glucose-stimulated Pancreatic Islets Are Not Causally Related
J. Biol. Chem., August 30, 2002; 277(36): 32883 - 32891.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. D. Chessler, W. T. Simonson, I. R. Sweet, and L. P. Hammerle
Expression of the Vesicular Inhibitory Amino Acid Transporter in Pancreatic Islet Cells : Distribution of the Transporter Within Rat Islets
Diabetes, June 1, 2002; 51(6): 1763 - 1771.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Bustamante, M. V. T. Lobo, F. J. Alonso, N.-T. A. Mukala, E. Gine, J. M. Solis, J. Tamarit-Rodriguez, and R. Martin Del Rio
An osmotic-sensitive taurine pool is localized in rat pancreatic islet cells containing glucagon and somatostatin
Am J Physiol Endocrinol Metab, December 1, 2001; 281(6): E1275 - E1285.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
P. Maechler and C. B Wollheim
Mitochondrial signals in glucose-stimulated insulin secretion in the beta cell
J. Physiol., November 15, 2000; 529(1): 49 - 56.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
F. Winnock, Z. Ling, R. De Proft, S. Dejonghe, F. Schuit, F. Gorus, and D. Pipeleers
Correlation between GABA release from rat islet beta -cells and their metabolic state
Am J Physiol Endocrinol Metab, April 1, 2002; 282(4): E937 - E942.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, Y.
Right arrow Articles by Baekkeskov, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, Y.
Right arrow Articles by Baekkeskov, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online