|
|
||||||||
-cells impairs first-phase insulin secretion
1 Departments of Medicine, Microbiology and Immunology, and Hormone Research Institute, 2 Department of Biochemistry and Biophysics and Metabolic Research Unit, 3 Department of Biochemistry and Biophysics and Hormone Research Institute, School of Medicine, University of California, San Francisco 94143; and 4 Department of Biology, University of California, Los Angeles, California 90095
| |
ABSTRACT |
|---|
|
|
|---|
The functional role of glutamate
decarboxylase (GAD) and its product GABA in pancreatic islets has
remained elusive. Mouse
-cells express the larger isoform GAD67,
whereas human islets express only the smaller isoform GAD65. We have
generated two lines of transgenic mice expressing human GAD65 in
pancreatic
-cells (RIP7-hGAD65, Lines 1 and 2) to study the effect
that GABA generated by this isoform has on islet cell function. The ascending order of hGAD65 expression and/or activity in
-cells was
Line 1 heterozygotes < Line 2 heterozygotes < Line 1 homozygotes. Line 1 heterozygotes have normal glucose tolerance,
whereas Line 1 homozygotes and Line 2 heterozygotes exhibit impaired
glucose tolerance and inhibition of insulin secretion in vivo in
response to glucose. In addition, fasting levels of blood glucose are
elevated and insulin is decreased in Line 1 homozygotes. Pancreas
perfusion experiments suggest that GABA generated by GAD65 may function as a negative regulator of first-phase insulin secretion in response to
glucose by affecting a step proximal to or at the KATP+ channel.
regulation of insulin secretion; neurotransmitter; pancreas perfusion; glucose intolerance
| |
INTRODUCTION |
|---|
|
|
|---|
PANCREATIC
-CELLS in islets of Langerhans express the enzyme
glutamate decarboxylase (GAD) and GABA at levels comparable to those
encountered in the central nervous system (14, 44, 57).
However, the physiological function of these molecules in islets
remains unclear (reviewed in 37, 53).
GABA produced in
-cells has been suggested to serve as a functional
regulator of pancreatic hormone release or as a paracrine signaling
molecule for communication between
-cells and the other endocrine
cells in islets of Langerhans (53). These hypotheses have
been tested by different investigators by use of in vitro assays and
exogenous GABA or its mimics. These investigations have yielded
conflicting data. In perfused rat and dog pancreas, GABA was shown to
inhibit arginine-stimulated insulin release (20, 27). In
contrast, perfusion of rat pancreas with GABA or GABA mimics had no
detectable effect on insulin secretion (14, 50).
Similarly, conflicting results have been reported on the effect of GABA
on glucagon and somatostatin secretion (13, 14, 27, 50,
51). There is convincing evidence to suggest that GABA may have
an inhibitory effect on glucagon release in vitro (13, 14,
51). It is not clear, however, whether GABA acts as a signal
molecule for glucose-induced inhibition of glucagon secretion
(14, 51).
There are at least two distinct GABA receptors for inhibitory
neurotransmission in the brain, GABAA and GABAB
receptors (26, 36). GABAA receptors, which
regulate chloride conductance and can cause cell inhibition by
hyperpolarization, are expressed on islet
- and
-cells but not on
-cells (51, 58). It has been proposed that the
inhibitory effect of GABA on glucagon secretion may be mediated by
GABAA receptors (13, 51). Recent results suggest that GABAB receptors are expressed in pancreatic
islets (Chang and Baekkeskov, unpublished results). GABAB
receptors are coupled to G proteins and can mediate inhibition of the
closure of K+ channels or the opening of Ca2+
channels (26 and references therein). A GABAB receptor
agonist has been reported to inhibit both insulin secretion and the
rise in cytoplasmic Ca2+ of
-cells (20).
In mammals, there are two highly homologous nonallelic isoforms of GAD,
GAD65 and GAD67 (11). The two forms differ mainly in their
association with the co-enzyme pyridoxal 5'-phosphate (PLP) (22,
35) and may differ in some aspects of subcellular targeting
(6, 7, 23, 25, 48, 54). GAD65, which is less saturated
with co-enzyme (22, 35), is found both in the cytosol and
associated with the cytosolic face of the membrane of synaptic-like
microvesicles in
-cells (6, 7, and unpublished results). GAD65 is
the major GAD isoform in rat islets and the only isoform in human
islets (28, 34, 45). In contrast, mouse
-cells seem to
express exclusively the cytosolic and highly PLP-saturated GAD67
isoform, even though both isoforms were detected at mRNA levels
(12, 28, 45-47). Perhaps not surprisingly, therefore, GAD65
/
mice exhibit normal glucose homeostasis (24).
Targeted disruption of the GAD67 gene in the mouse is more likely to
result in a phenotype because of loss of GABA in islets of Langerhans. Neonatal lethality of GAD67
/
mice has, however, precluded analysis of glucose homeostasis and islet cell function in mice deficient in
this isoform (2, 8). Targeted disruption of the genes encoding the GAD isoforms has therefore not provided information about
the role of GABA in the endocrine pancreas. Thus the role of GAD and
GABA in islets of Langerhans remains elusive.
The experiments reported so far on the effect of GABA on hormone
release in pancreatic islets have been limited to analyzing the effect
of exogenous GABA and GABA mimics, which may function differently from
the endogenous transmitter produced in
-cells. Thus the
physiological conditions that affect GABA synthesis and release may not
be approximated by the in vitro assays. Furthermore, the dose of
exogenous GABA used in most of the experiments may exceed the level of
endogenous GABA (53).
It is not clear how GABA release from
-cells is regulated in vivo.
GABA can be measured in conditioned medium from insulinoma cell lines
(13, 40, 55), but not from islets (40),
consistent with a paracrine rather than an endocrine function. There
are conflicting data as to whether the release from insulinoma cell lines is regulated by glucose (13, 40, 55).
To assess the role of GABA in pancreatic islets in an in vivo setting,
we have taken advantage of the low or absent expression of GAD65 in
mouse islets and targeted expression of this isoform to
-cells in
two lines of transgenic mice. We show in this study that expression of
transgenic GAD65 and elevated levels of GABA in pancreatic
-cells
result in inhibition of glucose-induced insulin release and impaired
glucose tolerance and diabetes in transgenic mice. Based on results of
studies of the perfused pancreas of transgenic and control mice, we
propose that GABA acts as a specific inhibitor of first-phase insulin
release and exerts its effect at a step before or at
-cell depolarization.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of transgenic mice.
A 9.7-kb rat insulin promoter sequence (RIP7), including the first
intron of the rat insulin II gene (41), was used to direct pancreatic
-cell specific expression of human GAD65. A transgenic construct (Fig. 1A) was
generated by inserting a 1,757-bp BamH I cDNA fragment
encoding the human GAD65 into a Cla I site of RIP7 at +180.
The RIP7 vector carries polyadenylation sequences from the SV-40 large
T antigen gene. To generate cohesive ends for ligation, the
BamH I fragment was partially filled with dGTP, dATP, and
dTTP, and the Cla I site with dCTP, by use of reverse transcriptase. The transgenic construct, RIP7-hGAD65, was linearized with Sal I and tested for transient expression in a
TC3
cell line (10) in parallel with transgenic constructs
generated by use of shorter versions of the rat insulin promoter, RIP1
and RIP5 (9, 30). The RIP7-hGAD65 construct was shown to
mediate the highest expression of GAD65. The distribution of the enzyme between cytosolic and membrane fractions was similar to rat islets (6) (results not shown). Two transgenic founder mice,
RIP7-hGAD65 mouse 1 and mouse 2, were generated
by microinjection of the RIP7-hGAD65 cDNA at a concentration of ~2
ng/ml into B6D2/F2 mouse embryos, according to established procedures
(21). RIP7-hGAD65 mouse 1 and mouse
2 were backcrossed into C57Bl/6 mice. Genetic transmission of the
transgene was assessed by Southern blot and by polymerase chain
reaction (PCR) analyses with DNA isolated from tail biopsies. Physiological studies were carried out on third- and fourth-generation backcrossed heterozygous 10- to 15-wk-old Line 1 and Line 2 mice. After
nine backcrosses into C57Bl/6 mice, Line 1 was bred to homozygosity, and homozygous mice were subjected to physiological studies at 8-15 wk of age. Control mice for all experiments with heterozygote transgenic mice were the transgene-negative littermates of the mice
analyzed. Control mice for homozygous Line 1 mice were wild-type C57Bl/6 mice of the same age and sex.
|
PCR analysis of transgenic expression. mRNA expression of the human GAD65 transgene in the transgenic line was analyzed by reverse transcriptase-polymerase chain reaction (RT-PCR) using a 5' primer from the 5' untranslated sequences of RIP7 (AAGTGACCAGCTACAGTCGG) and a 3' primer from the coding region of the human GAD65 gene (AGCAGGTCTGTTGCATGGAG). The tubulin gene was used as a control for the RT-PCR analyses. Total RNAs were isolated from freshly removed mouse pancreases using RNAzol (Tel-Test, Friendswood, TX), followed by digestion with RNase-free DNase I (Promega, Madison, WI) to remove contaminated genomic DNA. PCR amplification conditions were 94°C (2 min), followed by 35 cycles of 94°C (1 min), 60°C (1 min), 72°C (3 min), and finally 72°C for 10 min. The amplified DNA fragments (350 bp) were resolved on a 1.5%-agarose gel.
Immunohistochemical analysis. Immunohistochemical analysis of protein expression of the transgene was performed on frozen sections of mouse pancreas, as previously described (28), using a mixture of three human monoclonal antibodies to GAD65, MICA 2, 4, and 6 (49).
For immunohistochemical analysis of GABA expression, 25 ml of fixative containing 4% paraformaldehyde (Polyscience, PA) and 0.1% glutaraldehyde (Sigma, St. Louis, MO) in PBS, pH 7.3, were perfused directly into the left ventricle of transgenic mice and negative littermates. After perfusion, the pancreas was removed and postfixed in the same fixative for 1 h at 4°C. The tissue was rinsed in 30% sucrose-PBS overnight at 4°C, embedded in Optimal Cutting Temperature (OCT) embedding medium (Tissue Tek, Miles Diagnostic Division, Elkhart, IN), and stored at
80°C. Cryostat sections (20 µm) were fixed in
acetone for 15 min, washed in PBS for 15 min, and incubated with 0.2%
hydrogen peroxide-PBS for 30 min at room temperature. The sections were
blocked with 5% goat serum and 0.2% Triton X-100 in PBS for 30 min at
room temperature and incubated overnight at 4°C with rabbit anti-GABA
serum (serial dilutions 1:1,000-1:15,000; Incstar,
Stillwater, MN) followed by three washes with PBS and
incubation with fluorescein-conjugated goat anti-rabbit IgG (1:300;
Cappel, Westchester, PA) for 45 min at room temperature. After a wash
with PBS, sections were mounted in glycerol-PBS and analyzed by
fluorescence microscopy. Staining for insulin was carried out as
previously described (28).
Islet isolation and protein expression analysis. Mice were anesthesized with pentobarbital, and the pancreas was inflated with Hanks' balanced salt solution (HBSS; Sigma) before excision. Pancreases were subjected to two sequential incubations of 10 min each with collagenase type XI (Sigma) in a siliconized scintillation vial (2 pancreases per vial) at 37°C under vigorous shaking. The collagenase digest was washed three times in ice-cold HBSS containing 1% BSA (Sigma). Islets were mainly released in the second incubation and were handpicked several times under a stereomicroscope to reach 100% purity. Islets were subjected to a brief recovery period in RPMI 1640 and 10% FCS (GIBCO-BRL, Grand Island, NY), washed in PBS, and snap-frozen on dry ice.
For enzyme, protein, and Western blot assays, islets were extracted at a concentration of 10 islets/µl in 50 mM HEPES-NaOH, pH 7.0, 1 mM 2-aminoethylisothiouronium bromide, 1 mM phenylmethylsulfonyl fluoride, 10 mM benzamidine-HCl, 5 mM sodium fluoride, and 1% Triton X-114. After 1 h of incubation on ice, the lysate was centrifuged at 150,000 g for 1 h to remove cellular debris. For GAD activity assay, the supernatant was aliquoted and diluted in the same buffer without Triton X-114 but containing 0.1% BSA and 10 mM [1-14C]glutamate in the presence and absence of 0.1 mM PLP. Reactions were incubated for 2 h at 37°C and quenched by addition of 6 N HCl (5). Lysis buffer was used as a negative control in the presence and absence of PLP. Protein concentration in the different lysates was determined using the bicinchoninic acid protein assay reagent (Pierce, Rockford, IL) and BSA as standard. For analysis of GAD expression in islets by immunoblotting, aliquots of the islet lysates were boiled for 3 min in SDS sample buffer (62.5 mM Tris · HCl, pH 6.8, 2% SDS, 2.5%
-mercaptoethanol, 10%
glycerol, and 0.003% bromphenol blue) and then analyzed by SDS-PAGE on
10% polyacrylamide gels. Human GAD65 with a hexahistidine tag was
expressed and purified from Escherichia coli (unpublished results) and used as a quantitative standard. Resolved proteins were
transferred from gels by Western blotting to Protran BA nitrocellulose transfer membranes (Schleicher and Schuell) and immunostained as
described previously (23) with a rabbit antiserum, 1701, which recognizes GAD65 and GAD67 equally well. Furthermore, a GAD67-specific rabbit antiserum, K2 (Chemicon), was used to verify the
identity of endogenous GAD67 on Western blots. Antibody staining was
visualized using a horseradish peroxidase-coupled secondary antibody
and the enhanced chemiluminescence system (Amersham Pharmacia Biotech).
For quantitative analysis, images made on Kodak X-Omat film were
obtained at various times of exposure, and the amount of GAD65 and
GAD67 in the islet lysates was determined from the linear range of a
GAD65 standard curve. Scanning of autoradiograms was performed using
the DeskScan II program on a Hewlett-Packard ScanJet IIcx, and
densitometric analysis was performed using NIH Image software.
Glucose tolerance tests and measurement of insulin and glucagon secretion in vivo. Glucose tolerance tests were conducted in overnight-fasted animals, as previously described (30). Serum insulin levels were measured by radioimmunoassay with a kit (Binax, South Portland, MA) according to the manufacturer's instructions. Serum glucagon levels were measured by a double antibody radioimmunoassay with a kit from Diagnostic Products (Los Angeles, CA) according to the manufacturer's instructions.
Pancreatic perfusion. In vitro pancreas perfusion was performed as previously described for the mouse or Chinese hamster pancreas (17, 30, 32). Perfusate consisted of bicarbonate-phosphate-calcium buffer (17) containing 0.2% purified, "stabilized" bovine albumin and 3% T-40 Dextran (Aldrich Chemical, Milwaukee, WI). Perfusate was introduced into the celiac artery at 1 ml/min, and effluent was collected at 1- to 2-min intervals from the portal vein after a single passage through the pancreas. To minimize loss of soluble oxygen during the transit time from oxygenator to pancreas at these low flow rates (17), glass was employed for the influx tubing. As described (17), perfusate pressure was continuously monitored. Surgical integrity of the system was also evaluated by comparing perfusate inflow rate to efflux rate from the portal vein into the collection tubes. Experiments in which efflux rate was <80% of influx were discarded. As previously described (31), the pancreas was perfused in each experiment for 20 min without glucose to test for nonstimulated leakage or washout of insulin, a potential problem in perfusion experiments using mouse pancreas. This period was also used to establish whether the transgenic mouse pancreas released insulin in a constitutive manner (31). Agents, including glucose, IBMX (Aldrich Chemical), and KCl (Sigma), were added as indicated in the individual experiments. Insulin levels in pancreatic perfusate were measured by solid-phase radioimmunoassay (29), with rat insulin as the reference standard and antiporcine insulin antibody (Linco Research, Eureka, MO). Data analyses were carried out using Student's t-test for paired as well as unpaired values.
| |
RESULTS |
|---|
|
|
|---|
Heterozygous RIP7-hGAD65 transgenic mice express elevated levels of
GAD65 and GABA, and Line 2 has the highest expression.
The RIP7 transgenic vector directs high levels of
-cell specific
expression (41). An RIP7-hGAD65 construct was generated (Fig. 1A) and used for microinjection of mouse embryos.
Transgenic RIP7-hGAD65 lines were established from two founder mice
identified by Southern blot and PCR analyses. RT-PCR (Fig.
1B), immunohistochemical analysis (Fig.
2, a and b), and
immunoblot and enzyme assays (Fig. 3,
A and B) established expression of the transgene
in Lines 1 and 2. Thus immunofluorescence studies using human GAD65
specific monoclonal antibodies that recognize the mouse and human
protein equally well (28) revealed significant expression
of GAD65 in islets of both RIP7-hGAD65 Lines 1 and 2 heterozygous mice
(Fig. 2, a and b). At the heterozyygote stage,
the expression of GAD65 was highest in the RIP7-hGAD65 Line 2 islets.
As reported earlier (28), no expression of endogenous
GAD65 was detected in normal mouse pancreas by immunofluorescence
analysis (results not shown).
|
|
-cells, and GABA
generated by this isoform can be detected by immunofluorescence staining (52, 56). To analyze whether transgenic
expression of GAD65 resulted in increased levels of GABA in pancreatic
-cells, pancreatic sections from transgenic and nontransgenic
littermates of Line 2 were subjected to incubations with serial
dilutions of a GABA antiserum to test whether high dilutions could
reveal differences in expression between wild-type and transgenic mice. Dilutions of 1:7,500 and 1:10,000 revealed clear differences in GABA
levels between wild-type and transgenic islets (Fig. 2, c and d). At those dilutions, only about one-third of
wild-type islets stained for GABA, and the staining was weak (Fig. 2,
c). In contrast, 65-75% of transgenic islets were
strongly positive for GABA at the same dilutions (Fig. 2,
d), and the remainder was moderately or weakly positive.
Thus expression of RIP7-hGAD65 results in a significant increase in
expression of GAD65 as well as GABA in pancreatic
-cells.
Line 1 homozygotes express the highest levels of GAD65. After breeding of Line 1 to homozygosity, islets of Langerhans were isolated from Line 1 and Line 2 heterozygotes, from Line 1 homozygous mice, and from wild-type C57Bl/6 mice for analysis of GAD65 expression and activity. Immunoblot analysis was performed using the antibody 1701, which recognizes GAD65 and GAD67 equally well. In some experiments, equal amounts of protein were loaded from transgenic and wild-type islets (Fig. 3A), whereas in other experiments up to a fivefold excess of wild-type islets was loaded on the gel (results not shown). The analyses revealed a high expression of GAD65 in Line 1 and Line 2 transgenic mice, which was severalfold higher than expression of endogenous GAD67 in wild-type and transgenic mice (Fig. 3A). Overloading of protein and prolonged exposures of autoradiograms did not reveal expression of endogenous GAD65 in islets of wild-type mice (results not shown). Quantitative immunoblot analysis (a representative blot is shown in Fig. 3A) revealed that expression of GAD65 was highest in Line 1 homozygous mice, followed by Line 2 heterozygotes and then Line 1 heterozygotes. The levels of transgenic GAD65 exceeded endogenous GAD67 levels by ~8.7-fold (Line 1 homozygotes), 7.5-fold (Line 2 heterozygotes), and 4.5-fold (Line 1 heterozygotes). Thus Line 1 homozygotes, Line 2 heterozygotes, and Line 1 heterozygotes represent three distinct levels of GAD65 expression.
We next analyzed GAD enzyme activity in isolated islets from Line 1 heterozygotes, Line 2 heterozygotes, Line 1 homozygotes, and wild-type C57Bl/6 mice to confirm that the increased expression levels in transgenic mice also reflect increased enzyme activity in islets, and therefore a potential for GABA production. GAD65 provides the majority of PLP-inducible apoenzyme activity in brain but is also present as a holoenzyme (35). Enzyme analysis in the presence and absence of exogenous PLP revealed no PLP-inducible enzyme activity in wild-type C57Bl/6 mice, consistent with the absence of GAD65 in normal mouse islets. Approximately 1.6-fold and 3.4-fold increases in holoenzyme activity over wild-type mice were observed in Line 2 heterozygotes and in Line 1 homozygotes, respectively, whereas no increase was detected in Line 1 heterozygotes (Fig. 3B). Addition of PLP resulted in ~7-fold, 11-fold, and 15-fold increases in GAD activity in Line 1 heterozygotes, Line 2 heterozygotes, and Line 1 homozygotes, respectively. Thus transgenic GAD65 contributes to holoenzyme activity in the two highest expressing lines but most significantly enhances the apoenzyme pool in all three lines.Exhibition of impaired glucose tolerance and elevated blood sugars
in vivo in RIP7-hGAD65 transgenic mice.
We addressed the question of whether increased levels of GAD65 and GABA
affect glucose homeostasis. Blood glucose levels were analyzed in
transgenic mice after an overnight fast and at different time points
after glucose administration (Fig. 4).
Fasting blood glucose levels in transgenic and control mice were not
significantly different for Line 2 heterozygotes (Fig. 4B)
or in Line 1 heterozygotes (not shown). However, they were
significantly elevated in Line 1 homozygotes (Fig. 4A).
Analyses of blood glucose levels after intraperitoneal administration
of glucose revealed impaired glucose tolerance in Line 1 homozygotes
and in Line 2 heterozygotes (Fig. 4), whereas Line 1 heterozygotes
remained normal (results not shown). Blood glucose levels maximized at
20 min in control mice and approached basal values by 90 min. In
contrast, Line 1 homozygotes and Line 2 heterozygotes showed prolonged
high blood glucose levels. Whereas Line 2 mice reached normal blood
glucose levels at 150 min, glucose levels in Line 1 were still elevated
at 180 min (Fig. 4). Thus impairment of glucose tolerance is most
severe in Line 1 homozygotes, which express the highest levels of
antigen, and these mice also exhibit elevated fasting blood sugar.
|
Exhibition of decreased insulin secretion in vivo in transgenic
mice.
To assess whether the hyperglycemia in homologous Line 1 mice and
heterologous Line 2 mice was associated with abnormal secretion of
islet hormones, serum insulin and glucagon levels were monitored in
separate glucose stimulation experiments. No significant differences were found in serum glucagon levels between the transgenic and control
mice (data not shown). As shown in Fig.
5A, fasting serum insulin
levels were significantly lower in Line 1 homozygotes [0.33 ± 0.02 (SD) ng/ml] compared with control C57Bl/6 mice of the same age
and sex (0.42 ± 0.02 ng/ml; P < 0.01) and
remained significantly lower after administration of glucose. The
increment over basal in Line 1 homozygous mice was also significantly
different between transgenic and control animals at both 30 min
[0.11 ± 0.07 (SD) vs. 0.55 ± 0.14; P < 0.001] and 90 min (0.12 ± 0.07 vs. 0.87 ± 0.08;
P < 0.001). Although there was a tendency for lower
fasting serum insulin levels in Line 2 heterozygotes compared with
nontransgenic littermates, the differences were not statistically significant either in the set of animals shown in Fig. 5B or
in a set of 10 transgenic and 10 control animals subsequently analyzed. The combined data for basal insulin levels obtained for 15 transgenic Line 2 mice and 15 nontransgenic littermates of the same sex and age
were 0.20 ± 0.10 (SD) ng/ml for transgenic mice vs. 0.26 ± 0.17 ng/ml for control mice (P < 0.15). Administration
of glucose, however, elicited significantly lower blood insulin levels
in Line 2 mice at both 30 and 90 min (Fig. 5B). The
increment above basal in Line 2 heterozygotes was also significantly
different between transgenic and control animals, at both 30 min:
0.15 ± 0.15 (transgenic) vs. 0.47 ± 0.18 ng/ml (controls)
(P < 0.025) and at 90 min: 0.31 ± 0.22 (transgenic) vs. 0.84 ± 0.19 ng/ml (controls) (P < 0.001). These results suggest that the fasting hyperglycemia
observed in Line 1 homozygotes and the hyperglycemia measured during a
glucose tolerance test in both lines are caused by a decrease in
glucose-induced insulin secretion.
|
-cells for infiltration by mononuclear lymphocytes and
autoimmune destruction. However, hematoxylin-eosin staining (results
not shown) and immunostaining for insulin in pancreatic sections from RIP7-hGAD65 Line 1 (results not shown) and Line 2 mice (Fig. 2, compare
panels e and f) at different ages revealed no
insulitis and no loss of
-cells. Thus the decrease in insulin
secretion and abnormal glucose tolerance in transgenic mice are not the result of autoimmune processes and pancreatic
-cell destruction.
RIP7-hGAD65 Line 2 mice exhibit a selective inhibition of
first-phase insulin secretion in vitro.
To identify the nature of the inhibition of insulin secretion in
transgenic mice, the kinetics of insulin secretion during stimulation
with glucose and IBMX were examined using in vitro pancreas perfusion
of Line 2 heterozygotes. An initial perfusion without glucose
(31) showed no evidence of leakage or constitutive release
of insulin. Glucose at 7 mM was selected for the first stimulatory
step, because it approximates the basal glucose levels in those mice
(Fig. 6). It also is the level at which a
submaximal first-phase insulin release is consistently detected
(15) and can be used to assess either enhancement or
impairment of insulin secretion. This concentration of glucose elicited
a sharp first-phase insulin secretion from control pancreases (Fig. 6),
as previously reported (32). In contrast, the first-phase
insulin response of transgenic pancreases was significantly lowered
(17.38 ± 4.22 vs. 45.6 ± 5.07 ng/ml in nontransgenic
littermates; Fig. 6). Only a single time point at 38 min was
significantly suppressed during second-phase release in transgenic
mice. The perfused pancreas of both transgenic and control mice
responded to subsequent ascending levels of 11 and 22 mM glucose. The
declining insulin responses to higher glucose steps observed for both
transgenic and control mice (Fig. 6) have been previously shown
(15, 30) and were ascribed to a packet storage of insulin
with differing sensitivities to glucose, or alternatively to feedback
inhibition (43), also termed time-dependent inhibition
(42). In the presence of 22 mM glucose, IBMX, an inhibitor
of cAMP phosphodiesterase, potentiated the response to glucose with a
large and rapid increase in insulin secretion that was identical in
transgenic and control pancreases (Fig. 6). Hence, inhibition of
glucose-induced insulin secretion in RIP7-hGAD65 Line 2 heterozygous
mice primarily affects the first phase of insulin secretion in response
to physiological levels of glucose. The single time point that was
significantly suppressed during second-phase release could indicate an
additional minor effect on this phase.
|
A defect before membrane depolarization of the pancreatic
-cell.
Insulin secretion in response to glucose involves coordinated steps,
including 1) elevation of intracellular ATP levels as a
result of glucose metabolism; 2) closure of
sulfonylurea-sensitive KATP+ channels, and
-cell
depolarization; 3) activation of Ca2+ channels,
and oscillation of cytoplasmic Ca2+ levels; and
4) induction of exocytosis (1, 39). To assess whether the defect in first-phase insulin secretion in transgenic mice
is at a step before or after depolarization of the
-cell, K+ was used to artificially depolarize the
-cell and
bypass the closure of KATP+ channels in Line 2 heterozygotes. It has been shown that stimulation of the pancreas with
depolarizing concentrations of K+ alone primarily results
in first-phase insulin secretion (16). In such
experiments, glucose has an additive potentiating effect on insulin
release (18). Because we had found the response to glucose
to be atypical (Fig. 4), glucose was excluded in the experiments with
K+ to eliminate it as a variable and to allow a direct
measurement of the effect of depolarization on insulin release in the
transgenic and the normal pancreas. K+ at 20 mM stimulated
a sharp first-phase insulin response and a low prolonged insulin
secretion that were identical in transgenic and control mice (Fig.
7). A subsequent stimulation with
physiological glucose (7 mM) at 50 min again revealed a similar
defective first-phase insulin response in transgenic mice, much as when
glucose was used as the initial stimulus (compare Fig. 7 with Fig. 6).
Thus, in the same pancreas, both the normal response to K+
and the impaired response to glucose are demonstrable.
|
-cell secretory machinery, distal to the
-cell depolarization step, is normal in transgenic mice, suggesting
that the defect in first-phase insulin secretion is at a step either
before or involving the KATP+ channel itself.
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we show that expression of the smaller isoform of
the GABA synthesizing enzyme GAD in pancreatic
-cells of RIP7-hGAD65
transgenic mice results in elevated GAD enzyme activity and increased
GABA levels in
-cells. Line 1 heterozygotes, which have the lowest
expression of transgenic GAD65, do not display a phenotype. However,
homozygous mice of this line, which express almost twice the levels of
the enzyme, have the most severe phenotype and exhibit elevated fasting
blood glucose, impaired glucose tolerance, and inhibition of fasting as
well as glucose-induced insulin secretion. Line 2 heterozygotes, which
express ~1.6-fold the levels of Line 1 heterozygotes, have a more
subtle phenotype, which includes impaired glucose tolerance, inhibition
of insulin secretion in response to glucose, but normal fasting blood
glucose and insulin levels. Thus increasing levels of GAD65 expression
in the transgenic lines correlate with severity of the phenotype. Line
2 heterozygotes do not develop chronic hyperglycemia, diabetes, or
obesity over a lifespan of 2.5 yr (not shown). Line 1 homozygous mice
are currently being monitored over a prolonged period to assess these parameters.
Our in vitro studies, using the perfused pancreas in Line 2 heterozygotes, suggest that an inhibition of insulin secretion occurs
primarily at the first phase of insulin release stimulated at
physiological glucose levels. A single time point, however, was
significantly suppressed during second-phase release. Thus the
inhibitory effect may not be strictly limited to the first phase of
insulin secretion. These results are clearly distinct from a more
general inhibition of the insulin secretory pathway seen in perfusion
studies of some transgenic models, which overexpress membrane proteins
in pancreatic
-cells (19). The normal potentiating effect of IBMX in RIP7-hGAD65 mice suggests that the inhibition of
first-phase insulin secretion does not involve cAMP-mediated signaling pathways.
Whereas the in vivo analysis of RIP7-hGAD65 Line 2 mice showed a consistently impaired insulin release at all glucose levels during glucose challenge, the in vitro pancreas perfusion analysis detected impairment only at the first step of glucose stimulation (7 mM) but not at subsequent steps of 11 mM and 22 mM glucose. It is possible that, in vitro, the inhibitory effect of the elevated GABA levels is obscured by the nature of stepwise increments in glucose concentration and the lack of feedback mechanisms by circulating inhibitors and potentiators (15, 42, 43).
It was shown previously that stimulation of the pancreas with
depolarizing concentrations of K+ in the absence of glucose
causes mainly first-phase insulin secretion (16). In the
present study, we found that the response to K+ in the
transgenic pancreas is normal. These results indicate that the
-cell
machinery distal to
-cell depolarization, including Ca2+
channels and exocytosis of secretory vesicles, is intact in RIP7-hGAD65 transgenic mice. Thus inhibition of first-phase insulin secretion probably results from events occurring before membrane depolarization, in the glucose metabolic cascade, or at the K+ ATP channel
(1, 39).
How does GAD65/GABA expressed in
-cells exert an inhibitory effect
on first-phase insulin secretion? At least two possible mechanisms can
be proposed. First, recent evidence suggests that glutamate may act as
a messenger that enters secretory vesicles and induces their priming to
become part of a readily releasable pool of granules (33).
The levels of GAD65 in RIP7-hGAD65 Line 2 islets are similar to the
endogenous levels of the protein in rat and human islets, in which the
protein is still relatively rare (4). It is possible,
however, that transgenic GAD65 significantly affects levels of
glutamate (substrate), resulting in an inhibition of priming. Such
inhibition would, however, be predicted to affect mainly second-phase
insulin release, which is inconsistent with the observations in
RIP7-hGAD65 mice. The second possibility is that the phenotype of
RIP7-hGAD65 mice is mediated by the elevated levels of GABA synthesized
by GAD65. Metabolism of GABA in the tricarboxylic acid cycle via the
GABA shunt (38) seems to be excluded, because this process
is likely to generate ATP and stimulate insulin secretion.
Alternatively, GABA accumulated in vesicles and secreted from the
-cell may mediate a paracrine or autocrine inhibitory effect on
insulin secretion via GABA receptors. GABAA receptors are
expressed on
- or
-cells (51), and GABAB
receptors are expressed on
-cells (Chang and Baekkeskov, unpublished
results). One hypothesis is that GABA secreted by
-cells inhibits
first-phase insulin secretion in an autocrine fashion via G
protein-linked GABAB receptors.
Earlier studies, using exogenous GABA, have reported a wide variety of
effects on
-cell function, including a general inhibition of both
phases of insulin secretion, a stimulation of insulin secretion, or no
effect at all (37, 53 for review). The inherent contradiction of the
studies using exogenous GABA is not understood, but it may involve
differences in GABA uptake and/or transport in the different
experimental systems. Our results, with a transgenic model, which
increases GAD65 and GABA levels in
-cells, suggest that the action
of the endogenous transmitter synthesized in these cells is primarily,
although perhaps not exclusively, to regulate the first phase of
insulin secretion elicited by glucose at step(s) proximal to or at the
KATP+ channel.
| |
ACKNOWLEDGEMENTS |
|---|
We thank John Kim, Ann Neill, Raquel Nagal, and Mary Ann Jones for excellent technical assistance, and Patti Keefe for help with references.
| |
FOOTNOTES |
|---|
This study was supported by National Institutes of Health Grants R01 DK-47043 (to S. Baekkeskov) and P01 DK-41822 (to S. Baekkeskov and D. Hanahan), the Nora Eccles Treadwell Foundation (to S. Baekkeskov), an American Diabetes Association Mentor-Based Fellowship (to S. Baekkeskov), and a Fellowship Award from the Juvenile Diabetes Foundation International (to Y. Shi).
Present address of Y. Shi: Diabetes Research, Endocrine Division, Lilly Research Laboratories, Eli Lilly and Co., Indianapolis, IN 46285.
Address for reprint requests and other correspondence: S. Baekkeskov, Hormone Research Institute, Univ. of California San Francisco, 513 Parnassus Ave., Rm. HSW 1090, San Francisco, CA 94143-0534 (E-mail: s_baekkeskov{at}biochem.ucsf.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Received 5 August 1999; accepted in final form 25 April 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Aguilar-Bryan, L,
and
Bryan J.
Molecular biology of adenosine triphosphate-sensitive potassium channels.
Endocrine Rev
20:
101-135,
1999
2.
Asada, H,
Kawamura Y,
Maruyama K,
Kume H,
Ding RG,
Kanbara N,
Kuzume H,
Sanbo M,
Yagi T,
and
Obata K.
Cleft palate and decreased brain gamma-aminobutyric acid in mice lacking the 67-kDa isoform of glutamic acid decarboxylase.
Proc Natl Acad Sci USA
94:
6496-6499,
1997
3.
Bækkeskov, S,
Aanstoot HJ,
Christgau S,
Reetz A,
Solimena M,
Cascalho M,
Folli F,
Richter-Olesen H,
and
De-Camilli P.
Identification of the 64K autoantigen in insulin dependant diabetes as the GABA-synthesising enzyme glutamic acid decarboxylase.
Nature
347:
151-156,
1990[Medline].
4.
Baekkeskov, S,
Warnock G,
Christie M,
Rajotte RV,
Larsen PM,
and
Fey S.
Revelation of specificity of 64K autoantibodies in IDDM serums by high-resolution 2-D gel electrophoresis. Unambiguous identification of 64K target antigen.
Diabetes
38:
1133-1141,
1989[Abstract].
5.
Blindermann, JM,
Maitre M,
Ossola L,
and
Mandel P.
Purification and some properties of L-glutamate decarboxylase from human brain.
Eur J Biochem
86:
143-152,
1978[Web of Science][Medline].
6.
Christgau, S,
Aanstoot HJ,
Schierbeck H,
Begley K,
Tullin S,
Hejnaes H,
and
Baekkeskov S.
Membrane anchoring of the autoantigen GAD65 to microvesicles in pancreatic
-cells by palmitoylation in the N-terminal domain.
J Cell Biol
118:
309-320,
1992
7.
Christgau, S,
Schierbeck H,
Aanstoot HJ,
Aagaard L,
Begley K,
Kofod H,
Hejnaes K,
and
Baekkeskov S.
Pancreatic
-cells express two autoantigenic forms of glutamic acid decarboxylase, a 65kDa hydrophilic form and a 64kDa amphiphilic form which can be both membrane-bound and soluble.
J Biol Chem
266:
21257-21264,
1991
8.
Condie, BG,
Bain G,
Gottlieb DI,
and
Capecchi MR.
Cleft palate in mice with a targeted mutation in the gamma-aminobutyric acid-producing enzyme glutamic acid decarboxylase 67.
Proc Natl Acad Sci USA
94:
11451-11455,
1997
9.
Edwards, RH,
Rutter WJ,
and
Hanahan D.
Directed expression of NGF to pancreatic beta cells in transgenic mice leads to selective hyperinnervation of the islets.
Cell
58:
161-170,
1989[Web of Science][Medline].
10.
Efrat, S,
Linde S,
Kofod H,
Spector D,
Delannoy M,
Grant S,
Hanahan D,
and
Baekkeskov S.
Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene.
Proc Natl Acad Sci USA
85:
9037-9041,
1988
11.
Erlander, MG,
Tillakaratne NJ,
Feldblum S,
Patel N,
and
Tobin AJ.
Two genes encode distinct glutamate decarboxylases.
Neuron
7:
91-100,
1991[Web of Science][Medline].
12.
Faulkner-Jones, BE,
Cram DS,
Kun J,
and
Harrison LC.
Localization and quantitation of expression of two glutamate decarboxylase genes in pancreatic beta-cells and other peripheral tissues of mouse and rat.
Endocrinology
133:
2962-2972,
1993
13.
Gaskins, HR,
Baldeon ME,
Selassie L,
and
Beverly JL.
Glucose modulates gamma-aminobutyric acid release from the pancreatic beta TC6 cell line.
J Biol Chem
270:
30286-30289,
1995
14.
Gilon, P,
Bertrand G,
Loubatieres-Mariani MM,
Remacle C,
and
Henquin JC.
The influence of gamma-aminobutyric acid on hormone release by the mouse and rat endocrine pancreas.
Endocrinology
129:
2521-2529,
1991
15.
Grodsky, GM.
A threshold distribution hypothesis for packet storage of insulin and its mathematical modeling.
J Clin Invest
51:
2047-2059,
1972.
16.
Grodsky, GM,
Epstein GH,
Fanska R,
and
Karam JH.
Pancreatic action of the sulfonylureas.
Federation Proc
36:
2714-2719,
1977[Web of Science][Medline].
17.
Grodsky, GM,
and
Heldt A.
Method for the in vitro perfusion of the pancreas.
In: Methods in Diabetes Research, edited by Larner J,
and Pohl SL. New York: Wiley, 1984, p. 117-146.
18.
Grodsky, GM,
Lee JC,
and
Licko V.
Characteristics of multiphasic insulin release in vitro.
Proc Congr Int Diabetes Fed VII
231:
427-442,
1971. (Exerpta Medica Fndn Series)
19.
Grodsky, GM,
Ma YH,
Cullen B,
and
Sarvetnick N.
Effect on insulin production sorting and secretion by major histocompatibility complex class II gene expression in the pancreatic beta-cell of transgenic mice.
Endocrinology
131:
933-938,
1992
20.
Gu, XH,
Kurose T,
Kato S,
Masuda K,
Tsuda K,
Ishida H,
and
Seino Y.
Suppressive effect of GABA on insulin secretion from the pancreatic beta-cells in the rat.
Life Sci
52:
687-694,
1993[Web of Science][Medline].
21.
Hogan, B,
Costantini F,
and
Lacy E.
Anipulating the Mouse Embryo. Plainview, NY: Cold Spring Harbor Laboratory Press, 1986.
22.
Itoh, M,
and
Uchimura H.
Regional differences in cofactor saturation of glutamate decarboxylase (GAD) in discrete brain nuclei of the rat. Effect of repeated administration of haloperidol on GAD activity in sumstantia nigra.
Neurochem Res
6:
1283-1289,
1981[Web of Science][Medline].
23.
Kanaani, J,
Lissin D,
Kash SF,
and
Baekkeskov S.
The hydrophilic isoform of glutamate decarboxylase, GAD67, is targeted to membranes and nerve terminals independent of dimerization with the hydrophobic membrane-anchored isoform, GAD65.
J Biol Chem
274:
37200-37209,
1999
24.
Kash, SF,
Johnson RS,
Tecott LH,
Noebels JL,
Mayfield RD,
Hanahan D,
and
Baekkeskov S.
Epilepsy in mice deficient in the 65-kDa isoform of glutamic acid decarboxylase.
Proc Natl Acad Sci USA
94:
14060-14065,
1997
25.
Kaufman, DL,
Houser CR,
and
Tobin AJ.
Two forms of the
-aminobutyric acid synthetic enzyme glutamate decarboxylase have distinct intraneuronal distributions and cofactor interactions.
J Neurochem
56:
720-723,
1991[Web of Science][Medline].
26.
Kaupmann, K,
Huggel K,
Heid J,
Flor PJ,
Bischoff S,
Mickel SJ,
McMaster G,
Angst C,
Bittiger H,
Froestl W,
and
Bettler B.
Expression cloning of GABA(B) receptors uncovers similarity to metabotropic glutamate receptors.
Nature
386:
239-246,
1997[Medline].
27.
Kawai, K,
and
Unger RH.
Effects of gamma-aminobutyric acid on insulin, glucagon, and somatostatin release from isolated perfused dog pancreas.
Endocrinology
113:
111-113,
1983
28.
Kim, J,
Richter W,
Aanstoot HJ,
Shi Y,
Fu Q,
Rajotte R,
Warnock G,
and
Baekkeskov S.
Differential expression of GAD65 and GAD67 in human, rat, and mouse pancreatic islets.
Diabetes
42:
1799-1808,
1993[Abstract].
29.
Levin, SR,
Grodsky GM,
Hagura R,
and
Smith D.
Comparison of the inhibitory effects of diphenylhydantoin and diazoxide upon insulin secretion from the isolated perfused pancreas.
Diabetes
21:
856-862,
1972[Web of Science][Medline].
30.
Ma, YH,
Landis C,
Tchao N,
Wang J,
Rodd G,
Hanahan D,
Bourne HR,
and
Grodsky GM.
Constitutively active stimulatory G-protein alpha s in beta-cells of transgenic mice causes counterregulation of the increased adenosine 3',5'-monophosphate and insulin secretion.
Endocrinology
134:
42-47,
1994
31.
Ma, YH,
Lores P,
Wang J,
Jami J,
and
Grodsky GM.
Constitutive (pro)insulin release from pancreas of transgenic mice expressing monomeric insulin.
Endocrinology
136:
2622-2630,
1995[Abstract].
32.
Ma, YH,
Wang J,
Rodd GG,
Bolaffi JL,
and
Grodsky GM.
Differences in insulin secretion between the rat and mouse: role of cAMP.
Eur J Endocrinol
132:
370-376,
1995
33.
Maechler, P,
and
Wollheim CB.
Mitochondrial glutamate acts as a messenger in glucose-induced insulin exocytosis.
Nature
402:
685-689,
1999[Medline].
34.
Mally, MI,
Cirulli V,
Otonkoski T,
Soto G,
and
Hayek A.
Ontogeny and tissue distribution of human GAD expression.
Diabetes
45:
496-501,
1996[Abstract].
35.
Martin, DL,
Martin SB,
Wu SJ,
and
Espina N.
Regulatory properties of brain glutamate decarboxylase (GAD): the apoenzyme of GAD is present principally as the smaller of two molecular forms of GAD in brain.
J Neurosci
11:
2725-2731,
1991[Abstract].
36.
Mehta, AK,
and
Ticku MK.
An update on GABAA receptors.
Brain Res Brain Res Rev
29:
196-217,
1999[Medline].
37.
Michalik, M,
and
Erecinska M.
GABA in pancreatic islets: metabolism and function.
Biochem Pharmacol
44:
1-9,
1992[Web of Science][Medline].
38.
Michalik, M,
Nelson J,
and
Erecinska M.
GABA production in rat islets of Langerhans.
Diabetes
42:
1506-1513,
1993[Abstract].
39.
Miki, T,
Nagashima K,
and
Seino S.
The structure and function of the ATP-sensitive K+ channel in insulin-secreting pancreatic beta-cells.
J Mol Endocrinol
22:
113-123,
1999[Abstract].
40.
Nagamatsu, S,
Watanabe T,
Nakamichi Y,
Yamamura C,
Tsuzuki K,
and
Matsushima S.
Alpha-soluble N-ethylmaleimide-sensitive factor attachment protein is expressed in pancreatic beta cells and functions in insulin but not gamma-aminobutyric acid secretion.
J Biol Chem
274:
8053-8060,
1999
41.
Naik, P,
Karrim J,
and
Hanahan D.
The rise and fall of apoptosis during multistage tumorigenesis: down-modulation contributes to tumor progression from angiogenic progenitors.
Genes Dev
10:
2105-2116,
1996
42.
Nesher, R,
and
Cerasi E.
Biphasic insulin release as the expression of combined inhibitory and potentiating effects of glucose.
Endocrinology
121:
1017-1024,
1987
43.
O'Connor, MD,
Landahl H,
and
Grodsky GM.
Comparison of storage- and signal-limited models of pancreatic insulin secretion.
Am J Physiol Regulatory Integrative Comp Physiol
238:
R378-R389,
1980.
44.
Okada, Y,
Taniguchi H,
and
Schimada C.
High concentration of GABA and high glutamate decarboxylase activity in rat pancreatic islets and human insulinoma.
Science
194:
620-622,
1976
45.
Petersen, JS,
Russel S,
Marshall MO,
Kofod H,
Buschard K,
Cambon N,
Karlsen AE,
Boel E,
Hagopian WA,
Hejnaes KR,
Moody A,
Dyrberg T,
and
Lernmark
Å, Madsen OD, and Michelsen BK. Differential expression of glutamic acid decarboxylase in rat and human islets.
Diabetes
42:
484-495,
1993[Abstract].
46.
Pleau, JM,
Esling A,
Bach JF,
and
Dardenne M.
Gene expression of pancreatic glutamic acid decarboxylase in the nonobese diabetic mouse.
Biochem Biophys Res Commun
220:
399-404,
1996[Web of Science][Medline].
47.
Pleau, JM,
Throsby M,
Esling A,
and
Dardenne M.
Ontogeny of glutamic acid decarboxylase gene expression in the mouse pancreas.
Biochem Biophys Res Commun
233:
227-230,
1997[Web of Science][Medline].
48.
Reetz, A,
Solimena M,
Matteoli M,
Folli F,
Takei K,
and
DeCamilli P.
GABA and pancreatic
-cells: colocalization of glutamic acid decarboxylase (GAD) and GABA with synaptic like microvesicles suggests their role in GABA storage and secretion.
EMBO J
10:
1275-1284,
1991[Web of Science][Medline].
49.
Richter, W,
Shi Y,
and
Baekkeskov S.
Autoreactive epitopes in glutamic acid decarboxylase defined by diabetes-associated human monoclonal antibodies.
Proc Natl Acad Sci USA
90:
2832-2836,
1993
50.
Robbins, MS,
Grouse LH,
Sorenson RL,
and
Elde RP.
Effect of muscimol on glucose-stimulated somatostatin and insulin release from the isolated, perfused rat pancreas.
Diabetes
30:
168-171,
1981[Abstract].
51.
Rorsman, P,
Berggren PO,
Bokvist K,
Ericson H,
Mohler H,
Ostenson CG,
and
Smith PA.
Glucose-inhibition of glucagon secretion involves activation of GABA(A)-receptor chloride channels.
Nature
341:
233-236,
1989[Medline].
52.
Saravia-Fernandez, F,
Faveeuw C,
Blasquez-Bulant C,
Tappaz M,
Throsby M,
Pelletier G,
Vaudry H,
Dardenne M,
and
Homo-Delarche F.
Localization of gamma-aminobutyric acid and glutamic acid decarboxylase in the pancreas of the nonobese diabetic mouse.
Endocrinology
137:
3497-3506,
1996[Abstract].
53.
Satin, LS,
and
Kinard TA.
Neurotransmitters and their receptors in the islets of Langerhans of the pancreas: what messages do acetylcholine, glutamate, and GABA transmit?
Endocrine
8:
213-223,
1998[Web of Science][Medline].
54.
Shi, Y,
Veit B,
and
Baekkeskov S.
Amino acid residues 24-31 but not palmitoylation of cysteines 30 and 45 are required for membrane anchoring of glutamic acid decarboxylase, GAD65.
J Cell Biol
124:
927-934,
1994
55.
Smismans, A,
Schuit F,
and
Pipeleers D.
Nutrient regulation of gamma-aminobutyric acid release from islet beta cells.
Diabetologia
40:
1411-1415,
1997[Web of Science][Medline].
56.
Sorenson, RL,
Garry DG,
and
Brelje TC.
Structural and functional considerations of GABA in islets of Langerhans. Beta-cells and nerves.
Diabetes
40:
1365-1374,
1991[Abstract].
57.
Taniguchi, H,
Okada Y,
Seguchi H,
Shimada C,
Seki M,
Tsutou A,
and
Baba S.
High concentration of gamma-aminobutyric acid in pancreatic beta cells.
Diabetes
28:
629-633,
1979[Abstract].
58.
Yang, W,
Reyes AA,
and
Lan NC.
Identification of the GABAA receptor subtype mRNA in human pancreatic tissue.
FEBS Lett
346:
257-262,
1994[Web of Science][Medline].
59.
Yoon, JW,
Yoon CS,
Lim HW,
Huang QQ,
Kang Y,
Pyun KH,
Hirasawa K,
Sherwin RS,
and
Jun HS.
Control of autoimmune diabetes in NOD mice by GAD expression or suppression in beta cells.
Science
284:
1183-1187,
1999
This article has been cited by other articles:
![]() |
M. M. Bonaventura, P. N. Catalano, A. Chamson-Reig, E. Arany, D. Hill, B. Bettler, F. Saravia, C. Libertun, and V. A. Lux-Lantos GABAB receptors and glucose homeostasis: evaluation in GABAB receptor knockout mice Am J Physiol Endocrinol Metab, January 1, 2008; 294(1): E157 - E167. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wang, R. Mao, M. Van De Casteele, D. Pipeleers, and Z. Ling Glucagon-like peptide-1 stimulates GABA formation by pancreatic beta-cells at the level of glutamate decarboxylase Am J Physiol Endocrinol Metab, April 1, 2007; 292(4): E1201 - E1206. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wendt, B. Birnir, K. Buschard, J. Gromada, A. Salehi, S. Sewing, P. Rorsman, and M. Braun Glucose Inhibition of Glucagon Secretion From Rat {alpha}-Cells Is Mediated by GABA Released From Neighboring {beta}-Cells Diabetes, April 1, 2004; 53(4): 1038 - 1045. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Braun, A. Wendt, B. Birnir, J. Broman, L. Eliasson, J. Galvanovskis, J. Gromada, H. Mulder, and P. Rorsman Regulated Exocytosis of GABA-containing Synaptic-like Microvesicles in Pancreatic {beta}-cells J. Gen. Physiol., February 23, 2004; 123(3): 191 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. K. Franklin and C. B. Wollheim GABA in the Endocrine Pancreas: Its Putative Role as an Islet Cell Paracrine-signalling Molecule J. Gen. Physiol., February 23, 2004; 123(3): 185 - 190. [Full Text] [PDF] |
||||
![]() |
G. Bertrand, N. Ishiyama, M. Nenquin, M. A. Ravier, and J.-C. Henquin The Elevation of Glutamate Content and the Amplification of Insulin Secretion in Glucose-stimulated Pancreatic Islets Are Not Causally Related J. Biol. Chem., August 30, 2002; 277(36): 32883 - 32891. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Chessler, W. T. Simonson, I. R. Sweet, and L. P. Hammerle Expression of the Vesicular Inhibitory Amino Acid Transporter in Pancreatic Islet Cells : Distribution of the Transporter Within Rat Islets Diabetes, June 1, 2002; 51(6): 1763 - 1771. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bustamante, M. V. T. Lobo, F. J. Alonso, N.-T. A. Mukala, E. Gine, J. M. Solis, J. Tamarit-Rodriguez, and R. Martin Del Rio An osmotic-sensitive taurine pool is localized in rat pancreatic islet cells containing glucagon and somatostatin Am J Physiol Endocrinol Metab, December 1, 2001; 281(6): E1275 - E1285. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Maechler and C. B Wollheim Mitochondrial signals in glucose-stimulated insulin secretion in the beta cell J. Physiol., November 15, 2000; 529(1): 49 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Winnock, Z. Ling, R. De Proft, S. Dejonghe, F. Schuit, F. Gorus, and D. Pipeleers Correlation between GABA release from rat islet beta -cells and their metabolic state Am J Physiol Endocrinol Metab, April 1, 2002; 282(4): E937 - E942. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |