|
|
||||||||
Departments of Medicine and Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, South Carolina 29425
| |
ABSTRACT |
|---|
|
|
|---|
Obesity-resistant (A/J) and obesity-prone (C57BL/6J) mice were weaned onto low-fat (LF) or high-fat (HF) diets and studied after 2, 10, and 16 wk. Despite consuming the same amount of food, A/J mice on the HF diet deposited less carcass lipid and gained less weight than C57BL/6J mice over the course of the study. Leptin mRNA was increased in white adipose tissue (WAT) in both strains on the HF diet but to significantly higher levels in A/J compared with C57BL/6J mice. Uncoupling protein 1 (UCP1) and UCP2 mRNA were induced by the HF diet in brown adipose tissue (BAT) and WAT of A/J mice, respectively, but not in C57BL/6J mice. UCP1 mRNA was also significantly higher in retroperitoneal WAT of A/J compared with C57BL/6J mice. The ability of A/J mice to resist diet-induced obesity is associated with a strain-specific increase in leptin, UCP1, and UCP2 expression in adipose tissue. The findings indicate that the HF diet does not compromise leptin-dependent regulation of adipocyte gene expression in A/J mice and suggest that maintenance of leptin responsiveness confers resistance to diet-induced obesity.
uncoupling proteins; thermogenesis; adipose tissue
| |
INTRODUCTION |
|---|
|
|
|---|
ACCUMULATION OF EXCESS ADIPOSE TISSUE is a known risk factor for hypertension, heart disease, and non-insulin-dependent diabetes mellitus. The epidemic of obesity in Western society is associated with consumption of high-fat (HF) diets. A subset of the obese population appears sensitive to the diabetogenic effects of HF diets in that their obesity progresses to insulin resistance and diabetes. A similar variation in sensitivity to dietary fat has been documented in mice (19, 43, 44, 54), where particular strains readily develop an obese/diabetic syndrome after chronic consumption of HF diets. These susceptible strains provide excellent models to study the developmental pathophysiology of an obesity syndrome that is highly analogous to human obesity (5, 44, 54). Contrasting fat-sensitive with fat-resistant mouse strains serves the dual purpose of illustrating the molecular adaptations used to avoid obesity and of identifying genes that are sensitive to dysregulation by HF diets. The common factor in mice that are resistant to dietary fat is an ability to avoid obesity despite increased caloric density, but the cellular adaptations that confer this resistance are poorly understood.
The ability of uncoupling proteins (UCP) to modulate energetic efficiency comes from their ability to short-circuit the mitochondrial proton gradient that drives ATP synthesis (30, 35, 39). A cardinal property of adipose tissue is that its thermogenic capacity is directly related to the amount of UCP expressed in it (31, 42). It is well established that leptin regulates expression of the UCP1 gene (4, 11, 31), whereas dietary factors may play an important role in controlling expression of UCP2 (1, 15, 47) and UCP3 (25, 51, 53) and regulating leptin responsiveness. Thus the ability of an animal to respond to increased caloric density may be dictated by its ability to increase thermogenic capacity. Using mouse strains that differ in their sensitivity to HF diets, we show that fat-resistant A/J mice, but not fat-sensitive C57BL/6J mice, increase thermogenic capacity in brown (BAT) and white adipose tissue (WAT) in response to HF diet. These differences may be the product of strain-specific changes in expression of and subsequent responses to circulating leptin.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials.
EDTA, sodium cholate, Triton X-100, BSA, guanidinium thiocyanate, TES,
sucrose, and other common chemicals were from Sigma Chemical (St.
Louis, MO). T1 RNase and TRIzol LS reagent were from Life Technologies
(Gaithersburg, MD); T7 RNA polymerase, SP6 RNA polymerase,
Taq DNA polymerase, Moloney murine leukemia virus reverse
transcriptase, and the pGEM-3Z cloning vector were from Promega
(Madison, WI); and the T7 Megashortscript kit was purchased from Ambion
(Austin, TX). 2-Mercaptoethanol was acquired from J. T. Baker
(Phillipsburg, NJ); oligonucleotide primers were prepared by the DNA
Core Facility at the Medical University of South Carolina;
Na[125I] and
-[32P]cytidine triphosphate
were purchased from Du Pont NEN Radiochemicals (Boston, MA); and
Immobilon-P polyvinylidine fluoride membranes were from Millipore
(Bedford, MA). A semipurified HF diet was prepared by Research Diets
(New Brunswick, NJ) to contain 36% fat by weight (44),
and the low-fat (LF) control diet contained 5% fat, as described in
detail previously (44, 46). The fat source
for the diets was coconut and soybean oil (44). Male A/J
and C57BL/6J mice were obtained from Jackson Laboratories (Bar Harbor,
ME) at weaning. Serum insulin and leptin levels were estimated using
kits for rodent insulin and mouse leptin obtained from Linco Research
Labs (St. Charles, MO).
Experimental animal protocol. Fifty-six A/J and C57BL/6J mice were obtained at weaning, and eight animals of each strain were killed at time 0. One-half of the remaining animals of each strain were randomly assigned to receive either the LF or the HF diet (24 per strain per diet). The four groups of mice received their respective diets for 16 wk, and eight representative mice from each group were killed after 2, 10, or 16 wk on diet. At 2-wk intervals, food consumption was monitored in randomly selected groups of eight mice for 24-h periods. Animals were housed in a controlled environment at 22°C on a 12:12-h light-dark cycle with free access to food and water. Body weights were obtained twice weekly. Blood samples were obtained from each mouse at the time it was killed. Thereafter, interscapular BAT (IBAT), epididymal WAT (EWAT), and retroperitoneal WAT (RWAT) were carefully dissected from each animal for preparation of total RNA or isolation of adipocytes.
In an additional experiment, mice from each strain/diet combination were injected with vehicle or CL316,243 (1 µg· day
1·g body wt
1) for 2 days before they
were killed. The tissues were harvested and processed as described
above, and the mice were studied after 2 and 10 wk on the respective diets.
Preparation of RNA. After dissection, the interscapular, epididymal, and retroperitoneal fat pads were homogenized with TRIzol LS reagent using an Ultraturax (Tekmar, Cincinnati, OH) according to manufacturer's specifications. Total RNA was isolated and purified as previously described (21).
Ribonuclease protection assay.
RNA probes complementary to mRNA were produced by RT-PCR using total
RNA from mouse IBAT for UCP1 (5'-3':F, caatctgggcttaacgggt; R,
tgaaactccggctgagaag), UCP3 (5'-3':F, ccaccatggctgtgaagttcctg; R,
gggtgtacacctgcttgacggagtc), and
3-adrenergic receptor
(5'-3':F, accccagtgcagccaacacca; R, cgcaaccagtttcgcccaagg). Reverse
transcribed RNA from mouse EWAT was used for UCP2 (5'-3':F,
cagttctacaccaagggtc; R, aggtcataggtcaccagctca), and the UCP2 probe was
shortened to 143 bp by use of a Sma I digest, which cut the
fragment at a site corresponding to nucleotide 741. The respective
fragments were purified and cloned into the pGEM-3Z riboprobe vector
containing transcriptional start sites 5' and 3' to the multiple
cloning site (Promega, Madison, WI). The identities of the cloned
fragments were confirmed by sequencing, and the probes corresponded to
nucleotides 7-300 for UCP1, 741-884 for UCP2, 219-467
for UCP3, and 630-870 for the
3-adrenergic
receptor. The probe for mouse leptin was obtained from M. Daniel Lane.
The respective probes were labeled and used in our modification
(11, 21) of the ribonuclease protection assay
described by Granneman and Lahners (26). The protected
fragments were quantitated by comparison to known amounts of sense
strand RNA produced by SP6 transcription of the linearized plasmids and
incubated simultaneously with labeled probe. After digestion with 300 U
T1 RNase (Life Technologies), sense strand standards and protected
fragments were separated on 6% polyacrylamide/8 M urea gels and
visualized by autoradiography. Detected bands were quantitated by
scanning laser densitometry (Molecular Dynamics, Sunnyvale, CA). Bands
were standardized to the amount of 18S rRNA by cohybridizing with a
riboprobe complementary to the 18S rRNA (nucleotides 715-794).
Estimated concentrations of each mRNA were then determined by reverse
calibration from standard curves generated from the known amounts of
sense strand standards that were included in each assay.
Adenylylcyclase assay on adipocyte plasma membranes.
Adipocytes were isolated from the epididymal fat pads and used to
prepare plasma membranes, as described in detail previously (21, 22). The plasma membranes were used in
adenylylcyclase assays to assess the functional coupling of the
3-adrenergic receptor to its effector system among the
treatment groups, as described previously (8,
20, 21).
Methods of analysis.
The estimated concentrations of UCP1, UCP2, UCP3, leptin, and
3-adrenergic receptor mRNA were obtained by reverse
calibration from standard curves, as described in Ribonuclease
protection assay. Group means for mRNA estimates, growth data, and
plasma hormone concentrations were analyzed by means of a three-way
factorial design with strain, diet, and time as main effects. The
strain × diet × time interaction was tested by residual
variance (animal within strain × diet × month) as the error
term, and in the absence of such interactions, interest shifted to
strain × diet differences within each time point. Post hoc
testing of group means within each time point was made with the
Bonferroni correction, which used the pooled error term to calculate
standard errors. Protection against Type I errors was set at
5% (
= 0.05).
| |
RESULTS |
|---|
|
|
|---|
Growth and food consumption.
Body weights of mice within each strain were similar at the beginning
of the study (Fig. 1), as were the
weights of epididymal fat pads from representative mice of each strain
(Table 1). Fat pad weights were also
similar between the strains after mice consumed the LF diet for 2, 10, and 16 wk (Table 1). In mice mice consumed the LF diet, body weights
began to diverge after 4-5 wk, such that the C57BL/6J mice were
heavier (P < 0.05) at all subsequent time points (Fig.
1). The response between mouse strains on the HF diet was more
pronounced, and Fig. 1 illustrates that the C57BL/6J mice grew faster
and to higher weights than the A/Js (P < 0.05). The
strain difference was evident as early as 2 wk, and the fat pad weights
in the C57BL/6J mice were higher (P < 0.05) than those of the A/Js at the latter two time points (Table 1).
|
|
|
WAT gene expression.
To examine the basis for the apparent differences in plasma leptin
between A/J and C57BL/6J mice, we examined leptin mRNA in WAT from both
strains. Leptin mRNA levels in EWAT were comparable between strains at
the beginning of the study and changed little over time in either group
consuming the LF diet (Table 2). In contrast, differences were clearly evident in mice consuming the HF
diet, because leptin mRNA levels were significantly higher (P < 0.05) in A/J compared with C57BL/6J mice at the
2-wk time point (Table 2). This difference was also evident at 10 and
16 wk, because leptin mRNA levels were 50-100% higher in A/J than in C57BL/6J mice on the HF diet (Table 2). Leptin mRNA levels were also
higher (P < 0.05) in RWAT of A/J compared with
C57BL/6J mice (0.043 ± 0.006 vs. 0.020 ± 0.006 fmol
mRNA/µg RNA) consuming the HF diet at the 10-wk time point. Using two
different depot sites, we confirmed the results that leptin expression
is unexpectedly higher in A/J compared with C57BL/6J mice consuming the
HF diet.
|
3-adrenergic receptor agonist CL316,243 to test for
differences in inhibitory regulation of leptin expression. The results
from C57BL/6J mice on the LF diet were consistent with previous work
(9, 18, 23, 49) and
showed that CL316,243 produced a significant (P < 0.05) downregulation of leptin mRNA in mice at 2 and 10 wk (Fig. 3, A and B). The
opposite response was seen in A/J mice on the LF diet, where CL316,243
failed to decrease leptin mRNA in WAT at either time point (Fig. 3,
A and B). Consumption of the HF diet transformed
the response to CL316,243 in both groups, but the change in response
was dependent on time. This produced a strain × diet × time
interaction (P < 0.05) and indicates that the effect
of each diet over time differed between the strains. For instance, in
C57BL/6J mice, the HF diet blunted the inhibition of leptin mRNA
expression by CL316,243 at both time points, although a modest but
significant (P < 0.05) effect could be detected at 10 wk (Fig. 3B). In contrast, the HF diet enabled the response in A/J mice, such that CL316,243 produced a significant reduction (P < 0.05) in leptin mRNA at both 2 and 10 wk (Fig.
3B).
|
3-adrenergic receptor.
3-Adrenergic
receptor mRNA levels were similar in EWAT from A/J and C57BL/6J mice
(0.23 ± 0.03 and 0.28 ± 0.02 fmol mRNA/µg RNA) at the
beginning of the study and were comparable at 10 wk in mice on both
diets (A/J LF 0.36 ± 0.09, A/J HF 0.48 ± 0.09, C57BL/6J LF
0.38 ± 0.09, C57BL/6J HF 0.31 ± 0.09 fmol/µg RNA). In
contrast, after 16 wk on the HF diet,
3-adrenergic
receptor mRNA levels were significantly higher (P < 0.05) in A/J compared with C57BL/6J mice (0.73 ± 0.05 vs. 0.50 ± 0.05 fmol/µg RNA). Measurements of mRNA were
complemented by adenylylcyclase assays in adipocyte membranes from each
group to compare functional activity of the
3-adrenergic
receptor. When the
3-selective agonist CL316,243 was
used, maximal adenylylcyclase activation was significantly lower
(P < 0.05) in adipocyte membranes from C57BL/6J
compared with A/J mice (190 ± 9.7 vs. 268 ± 12.9 pmol
cAMP·min
1·mg protein
1) after 16 wk on
the HF diet. In contrast, maximal adenylylcyclase activation was
comparable between HF-fed mice at 2 wk (A/J 151 ± 12, C57BL/6J
139 ± 9 pmol cAMP·min
1·mg
protein
1) and at 10 wk (A/J 130 ± 8, C57BL/6J
141 ± 7 pmol
cAMP·min
1·mg
protein
1). The observed changes in functional
activity of the
3-adrenergic receptor in adipocyte
membranes from each group parallel the observed changes in
3-adrenergic receptor mRNA among the groups. These findings indicate that compromised
3-adrenergic
receptor-mediated signaling develops in C57BL/6J mice only after
long-term consumption of the HF diet and do not predate the development
of altered leptin regulation or obesity in these mice.
Because WAT is one of the primary sites of UCP2 expression, UCP2 mRNA
levels were measured in EWAT to test the hypothesis that UCP2 is
differentially upregulated between the mouse strains in response to a
HF diet. UCP2 mRNA levels were similar between A/J and C57BL/6J mice
(0.27 ± 0.06 and 0.30 ± 0.02 fmol mRNA/µg RNA) at the
beginning of the study and were unchanged from these initial levels in
C57BL/6J mice, regardless of diet (Fig.
4A; Table 2). In contrast,
UCP2 mRNA levels in A/J mice were significantly increased
(P < 0.05) from these initial levels at 2, 10, and 16 wk on the LF diet (Fig. 4A; Table 2). Moreover, weaning A/J
mice onto the HF diet produced a further significant increase
(P < 0.05) in UCP2 mRNA levels at each time point
(Fig. 4B; Table 2). Compared with C57BL/6J mice on the HF
diet, UCP2 mRNA levels in A/J mice were two- to fourfold higher at each
time point (Fig. 4B; Table 2). These results indicate a
clear strain difference in the adaptive response of WAT to HF diets.
|
|
BAT gene expression.
BAT UCP1 mRNA levels were similar between C57BL/6J and A/J mice
(4.22 ± 0.22 and 3.74 ± 0.12 fmol UCP1 mRNA/µg RNA) at
the start of the experiment and between A/J and C57BL/6J mice on the LF
diet at all but the initial time point over the course of the study
(Fig. 6; Table 2). UCP1 mRNA levels were
also similar between the mouse strains after 2 wk on the HF diet, but
at both 10 and 16 wk, UCP1 mRNA was significantly higher
(P < 0.05) in BAT from A/J compared with C57BL/6J mice
(Fig. 6; Table 2). Thus A/J mice responded to the HF diet by increasing
UCP1 mRNA levels, whereas the C57BL/6J mice failed to respond in a
comparable manner.
|
3-adrenergic receptor mediates many of the
effects of sympathetic stimulation of BAT, it plays a central role in
mediating the effects of sympathetic regulation of UCP1 expression. Therefore, we compared
3-adrenergic receptor mRNA levels
among the groups to determine whether compromised receptor expression could account for strain differences in UCP1 induction.
3-Adrenergic receptor mRNA levels were 1.7-fold higher
in A/J compared with C57BL/6J mice (0.73 ± 0.04 vs. 0.44 ± 0.04 fmol mRNA/µg RNA) at the beginning of the study and were
essentially unchanged in A/J and C57BL/6J mice (0.67 ± 0.05 vs.
0.46 ± 0.03 fmol mRNA/µg RNA) after 16 wk on the HF diet. This
finding suggests that diet-induced differences in UCP1 mRNA levels
between the strains are not due to diet-induced changes in
3-adrenergic receptor expression in BAT.
BAT UCP3 mRNA levels were similar between A/J and C57BL/6J mice
(0.017 ± 0.002 and 0.018 ± 0.003 fmol UCP3 mRNA/µg RNA)
at the start of the study and changed little within the groups during the progression of the study (Table 2). In contrast to UCP1, UCP3 mRNA
was unaffected by diet in both mouse strains and was expressed at
fairly uniform levels across mouse strain and diet (Table 2).
Considered together, the results are inconsistent with the hypothesis
that BAT UCP1 and UCP3 mRNA are regulated by a common signal unless the
threshold for induction is substantially different between the two proteins.
| |
DISCUSSION |
|---|
|
|
|---|
The translated product of the ob gene regulates food consumption by communicating the status of peripheral adipose stores to the brain (17, 55). Recent evidence indicates that leptin also regulates energy expenditure through the sympathetic nervous system by enhancing UCP1 expression in both BAT and WAT (2, 10, 11, 32, 33). The consensus is that leptin is the afferent signal in a feedback loop between adipose tissue and the brain that acts to regulate both energy intake and expenditure. This paradigm predicts that animals will respond to diets of high caloric density by reducing food intake and increasing energy expenditure. In the present work, C57BL6/J mice failed to fulfill this prediction and are among several strains of mice classified as "sensitive" to HF diets (5, 43, 44). In contrast, A/J mice are classified as "fat resistant," because they do not develop the associated diabetic pathologies on HF diets and become only moderately obese (43, 44). The present findings are consistent with these classifications and show that C57BL/6J mice grow faster and deposit significantly more fat than A/J mice at similar or lower rates of food consumption. Taken together, these findings demonstrate a fundamental difference in energy requirements for body weight maintenance between these mouse strains and argue that the ability of leptin to match rates of food intake and energy utilization was differentially compromised by the HF diet. Therefore, the major goal of the present study was to examine the regulation of leptin expression and function as a basis for the differing propensities of C57BL/6J and A/J mice to become obese.
Plasma leptin levels were initially similar between the mouse strains, but after 2 wk on the HF diet, leptin levels were higher in A/J than in C57BL/6J mice. The data suggest that plasma leptin was also higher in A/J mice at 10 and 16 wk, but the variability of the observations precluded detection of this difference. Surwit et al. (45) reported a similar disproportionate increase in plasma leptin in A/J compared with C57BL/6J mice after 2-4 wk on HF diet. This is surprising, given the greater fat deposition in C57BL/6J compared with A/J mice, and it suggests that leptin expression per unit of adipose tissue was actually higher in A/J compared with C57BL/6J mice. To test this hypothesis, we compared leptin mRNA levels in two WAT depot sites from mice of each strain. The findings from these studies are consistent with our hypothesis at all time points. These differences are particularly important because they occurred during the initial 10 wk of the study, when fat deposition was clearly occurring at a faster rate in C57BL/6J compared with A/J mice. Given its demonstrated role in regulating energy utilization and fat oxidation (10, 11, 32, 33, 52), the higher leptin expression in A/J compared with C57BL/6J mice may have contributed to the observed differences in fat accumulation by increasing peripheral energy utilization in A/J mice. Support for this suggestion comes from Surwit et al., who reported that core temperatures were higher in A/J vs. C57BL/6J mice consuming HF diets. Lower body temperature is a distinguishing characteristic of ob/ob mice, and replacement of the missing leptin restores body temperature to normal (40), ostensibly by increasing UCP1 expression (11) and thermogenic activity in BAT. Similar observations were evident in the present study, where the higher leptin expression in A/J mice on HF diets was mirrored by higher UCP1 mRNA levels in BAT from these mice. These findings support the concept that disproportionately higher leptin expression in A/J compared with C57BL/6J mice lessens their energetic efficiency by increasing nonshivering thermogenesis.
The hypothesis that high caloric density mobilizes a more vigorous thermogenic response in A/J compared with C57BL/6J mice is also supported by measurements of UCP2 mRNA, where levels were significantly higher in WAT from A/J mice. These findings are similar to results reported by Fleury et al. (15) and Surwit et al. (47), with two subtle but important differences. First, our results show that UCP2 mRNA expression in adipose tissue was comparable between the strains at weaning, with strain and diet-associated differences developing thereafter. Second, the present work shows that UCP2 mRNA levels were consistently higher in A/J than in C57BL/6J mice after 2, 10, and 16 wk on the HF diet. The previous study (15) had found a similar difference at early time points but actually found higher levels of UCP2 mRNA in C57BL/6J compared with A/J mice later in that study. Although UCP2 has been shown to lower yeast membrane potential and uncouple respiration (15, 34), the functional significance of increased UCP2 mRNA in the present system is unknown. If increased mRNA levels are matched by increased protein expression, then it seems likely that decreased metabolic efficiency would result. In contrast to UCP1 and UCP2, no evidence was found to support a role for UCP3 in diet-induced obesity.
The mechanism for increased UCP2 expression in A/J compared with
C57BL/6J mice is unknown. Although initial reports suggested that UCP2
was regulated by leptin (56) or by norepinephrine (3), a number of other studies have questioned these
findings (11, 15, 24,
25). For instance, we showed that UCP2 was unchanged in
retroperitoneal WAT from mice in which leptin treatment induced UCP1
expression in the same tissue (11). Therefore, it seems
unlikely that the higher leptin expression in A/J mice is the basis for
the observed strain differences in UCP2 mRNA. What seems more likely is
that UCP2 expression was differentially affected between strains by
dietary fat. Support for this suggestion comes from reports showing
that UCP2 expression is responsive to changes in circulating free fatty
acids (25, 41), and from the work of Aubert
et al. (1), who showed that peroxisome
proliferator-activated receptor-
2 (PPAR
2)
agonists increased UCP2 mRNA in adipocytes. Given that fatty acids can
transcriptionally activate PPAR
-sensitive genes (16)
and the recent report showing that PPAR
expression level influenced
adipocyte gene expression (36), the possibility of strain
differences in signaling through this pathway warrants further study.
Observed differences in circulating leptin and tissue mRNA suggest that
regulation of this gene differs between the two mouse strains. Based on
recent reports showing that leptin expression is inhibited by
adrenergic stimulation of adipose tissue (9, 10, 48, 49), we explored the
possibility that inhibitory regulation of leptin expression was
differentially compromised in mice of each strain by the HF diet. The
results from studies using a selective
3-adrenergic
receptor agonist were surprising and showed that the HF diet
completely transformed the inhibitory response in each mouse strain.
For instance, CL316, 243 failed to reduce leptin mRNA in A/J mice
consuming the LF diet, whereas A/J mice on the HF diet showed a robust
agonist-induced reduction in leptin mRNA. In contrast, the
CL316,243-mediated reduction in leptin mRNA noted in C57BL/6J mice on
the LF diet was essentially absent in C57BL/6J mice on the HF diet. A
potential explanation for diet-induced transformation of the response
could be changes in
-adrenergic receptor expression. Collins et al.
(7) examined this question in C57BL/6J and A/J mice fed HF
diets for 16 wk and found greater reductions in
3-adrenergic receptor mRNA and function in WAT from
C57BL/6J mice. We found comparable reductions in
3-adrenergic receptor mRNA and function in C57BL/6J mice
at 16 wk, but the observed differences in inhibitory regulation of leptin expression occurred at earlier time points (2 and 10 wk), when
we found no evidence of compromised expression or function of the
receptor. Although leptin expression involves a number of hormonal
inputs (12-14, 38), a recent study
showed that reduced expression of PPAR
in adipose tissue had a
profound effect on leptin expession levels (36). Leptin
expression was disproportionately high in relation to adipose tissue
mass, producing leaner mice with elevated metabolic rates
(36). In that study, the authors showed that changes in
regulatory factors and systems that impact adipocyte gene expression
are capable of transforming obesity-prone mice into mice that are
resistant to diet-induced obesity (36).
It is reasonable to assume that differences in inhibitory regulation of leptin expression are not the sole basis for the differences noted in the present work. Our results, however, make a strong case that leptin expression and its regulation are fundamentally different in WAT from A/J and C57BL/6J mice. Because cAMP-dependent mechanisms are also important in regulating leptin release from adipocytes (18), it will be important to establish whether the observed strain differences in gene transcription extend to leptin release from the adipocyte.
Strain and diet-dependent differences in adipocyte gene expression could also be related to differences in the proliferative state within adipocyte depots. For instance, diet-induced differences in hyperplastic growth within white fat depot sites could impact circulating leptin levels through an increase in leptin expressing cells. Although cell numbers were not determined in the present study, Surwit et al. (43) found a 40% increase in adipocytes in white fat depots from C57BL/6J mice that had consumed the high-fat diet for 16 wk. In contrast, no evidence of hyperplasia was found in A/J mice on the same diet (43). Therefore, these findings are inconsistent with the suggestion that increased leptin expression in A/J mice is caused by adipocyte hyperplasia; rather, these data support the conclusion that leptin expression per adipocyte is higher in WAT from A/J compared with C57BL/6J mice.
Recent evidence suggests that diet-induced obesity is associated with
the development of leptin resistance (28, 37,
50). Our studies show that, despite robust increases in
circulating leptin, strain differences in body weight and fat accretion
occurred at similar rates of food consumption. These findings suggest
that strain differences in energy utilization reflect either a relative leptin insufficiency or a compromised ability of leptin to induce thermogenic capacity and activity in C57BL6/J compared with A/J mice.
The present studies do not distinguish between these possibilities, but
it should be noted that several mouse models of diet-induced obesity
display peripheral but not central leptin resistance (6, 50). Leptin resistance may also occur through diet-induced
effects on signaling components in target tissues. An example would be the diet-induced reduction of
3-adrenergic receptor
expression in C57BL/6J mice, which could limit the ability of adipose
tissue to respond to sympathetic stimulation. This seems unlikely in the present study, because differential fat accumulation occurred well
before any change in
-adrenergic signaling efficacy. Our findings
are more consistent with changes in downstream signaling components
that modify the set points for leptin release between the two mouse
strains. The present studies do not exclude central leptin resistance
as a contributing mechanism of diet-induced obesity; rather they
demonstrate fundamental differences in the regulation of adipocyte gene
expression between A/J and C57BL/6J mice. It will be important in
future studies to assess the relative importance of altered leptin
expression vs. central and peripheral mechanisms of leptin resistance
in various models of diet-induced obesity.
| |
ACKNOWLEDGEMENTS |
|---|
The authors acknowledge the excellent technical assistance of Isabel Frampton and Jami Kelley.
| |
FOOTNOTES |
|---|
This work was supported by a research grant from the American Diabetes Association (T. W. Gettys), National Institute of Diabetes and Digestive Kidney Diseases Grant DK-53981 (T. W. Gettys), and Research Grant No. 9800699 from the US Department of Agriculture NRICGP/USDA (T. W. Gettys).
Address for reprint requests and other correspondence: T. W. Gettys, 916-G Clinical Science Bldg., Medical University of South Carolina, 96 Jonathan Lucas St. Charleston, SC 29425 (E-mail: gettystw{at}musc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Received 15 December 1999; accepted in final form 8 March 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Aubert, J,
Champigny O,
Saint-Marc P,
Negrel R,
Collins S,
Ricquier D,
and
Ailhaud G.
Up-regulation of UCP-2 gene expression by PPAR agonists in preadipose and adipose cells.
Biochem Biophys Res Commun
238:
606-611,
1997[Web of Science][Medline].
2.
Bartness, TJ,
and
Bamshad M.
Innervation of mammalian white adipose tissue: implications for the regulation of total body fat.
Am J Physiol Regulatory Integrative Comp Physiol
275:
R1399-R1411,
1998
3.
Boss, O,
Samec S,
Dulloo A,
Seydoux J,
Muzzin P,
and
Giacobino JP.
Tissue-dependent upregulation of rat uncoupling protein-2 expression in response to fasting or cold.
FEBS Lett
412:
111-114,
1997[Web of Science][Medline].
4.
Bouillaud, F,
Ricquier D,
Mory G,
and
Thibault J.
Increased level of mRNA for the uncoupling protein in brown adipose tissue of rats during thermogenesis induced by cold exposure or norepinephrine infusion.
J Biol Chem
259:
11583-11586,
1984
5.
Bray, GA.
Obesity, a disorder of nutrient partitioning: the MONA LISA hypothesis.
J Nutr
121:
1146-1162,
1991.
6.
Campfield, LA,
Smith FJ,
Guisez Y,
Devos R,
and
Burn P.
Recombinant mouse ob protein: evidence for a peripheral signal linking adiposity and central neural networks.
Science
269:
546-549,
1995
7.
Collins, S,
Daniel KW,
Petro AE,
and
Surwit RS.
Strain-specific response to
3-adrenergic receptor agonist treatment of diet-induced obesity in mice.
Endocrinology
138:
405-413,
1997
8.
Collins, S,
Daniel KW,
Rohlfs EM,
Ramkumar V,
Taylor IL,
and
Gettys TW.
Impaired expression and functional activity of the
-3 and
-1 adrenergic receptor in adipose tissue of congenitally obese (C57BLJ6-ob/ob) mice.
Mol Endocrinol
8:
518-527,
1994
9.
Collins, S,
and
Surwit RS.
Pharmacologic manipulation of ob expression in a dietary model of obesity.
J Biol Chem
271:
9437-9440,
1996
10.
Commins, SP,
Marsh DJ,
Thomas SA,
Watson PM,
Padgett MA,
Palmiter RD,
and
Gettys TW.
Norepinephrine is required for leptin effects on gene expression in brown and white adipose tissue.
Endocrinology
140:
4772-4776,
1999
11.
Commins, SP,
Watson PM,
Padgett MA,
Dudley A,
Argyropoulos G,
and
Gettys TW.
Induction of uncoupling protein expression in brown and white adipose tissue by leptin.
Endocrinology
140:
292-300,
1999
12.
De Vos, P,
Lefebvre AM,
Miller SG,
Guerre-Millo M,
Wong K,
Saladin R,
Hamann LG,
Staels B,
Briggs MR,
and
Auwerx J.
Thiazolidinediones repress ob gene expression in rodents via activation of peroxisome proliferator-activated receptor gamma.
J Clin Invest
98:
1004-1009,
1996[Web of Science][Medline].
13.
De Vos, P,
Lefebvre AM,
Shrivo I,
Fruchart JC,
and
Auwerx J.
Glucocorticoids induce the expression of the leptin gene through a nonclassical mechanism of transcriptional activation.
Eur J Biochem
253:
619-626,
1998[Web of Science][Medline].
14.
Escobar-Morreale, HF,
Del Rey FE,
and
De Escobar GM.
Thyroid hormones influence serum leptin concentrations in the rat.
Endocrinology
138:
4485-4488,
1997
15.
Fleury, C,
Neverova M,
Collins S,
Raimbault S,
Champigny O,
Levi-Meyrueis C,
Bouillaud F,
Seldin MF,
Surwit RS,
Ricquier D,
and
Warden CH.
Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia.
Nat Genet
15:
269-272,
1997[Web of Science][Medline].
16.
Forman, BM,
Tontonoz P,
Chen J,
Brun RP,
Spiegelman BM,
and
Evans RM.
15-Deoxy-Delta12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPARgamma.
Cell
83:
803-812,
1995[Web of Science][Medline].
17.
Frederich, RC,
Hamann A,
Anderson S,
Löllmann B,
Lowell BB,
and
Flier JS.
Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action.
Nat Med
1:
1311-1314,
1995[Web of Science][Medline].
18.
Gettys, TW,
Harkness PJ,
and
Watson PM.
The
3-adrenergic receptor inhibits insulin-stimulated leptin secretion from isolated rat adipocytes.
Endocrinology
137:
4054-4057,
1996[Abstract].
19.
Gettys, TW,
Ramkumar V,
Surwit R,
and
Taylor IL.
Tissue specific alterations in G protein expression in genetic vs diet-induced models of NIDDM in the mouse.
Metabolism
44:
771-778,
1995[Web of Science][Medline].
20.
Gettys, TW,
Rohlfs EM,
Prpic V,
Daniel KW,
Taylor IL,
and
Collins S.
Age-dependent changes in
-adrenergic receptor subtypes and adenylyl cyclase activation in adipocytes from Fischer 344 rats.
Endocrinology
136:
2022-2032,
1995[Abstract].
21.
Gettys, TW,
Watson PM,
Seger L,
Padgett M,
and
Taylor IL.
Adrenalectomy after weaning restores
3-adrenergic receptor expression in white adipocytes from C57BL/6J mice.
Endocrinology
138:
2697-2704,
1997
22.
Gettys, TW,
Watson PM,
Taylor IL,
and
Collins S.
RU-486 (Mifepristone) ameliorates diabetes but does not correct deficient
-adrenergic signaling in adipocytes from mature C57BL/6J-ob/ob mice.
Int J Obes
21:
865-873,
1997.
23.
Giacobino, JP.
Role of the
3-adrenoceptor in the control of leptin expression.
Horm Metab Res
28:
633-637,
1996[Web of Science][Medline].
24.
Gimeno, RE,
Dembski M,
Weng X,
Deng N,
Shyjan AW,
Gimeno CJ,
Iris F,
Ellis SJ,
Woolf EA,
and
Tartaglia LA.
Cloning and characterization of an uncoupling protein homolog. A potential molecular mediator of human thermogenesis.
Diabetes
46:
900-906,
1997[Abstract].
25.
Gong, DW,
He YF,
Karas M,
and
Reitman M.
Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone,
3-adrenergic agonists, and leptin.
J Biol Chem
272:
24129-24132,
1997
26.
Granneman, JG,
and
Lahners KN.
Analysis of human and rodent beta 3-adrenergic receptor messenger ribonucleic acids.
Endocrinology
135:
1025-1031,
1994[Abstract].
27.
Guerra, C,
Koza RA,
Yamashita H,
Walsh K,
and
Kozak LP.
Emergence of brown adipocytes in white fat in mice is under genetic control
effects on body weight and adiposity.
J Clin Invest
102:
412-420,
1998[Web of Science][Medline].
28.
Halaas, JL,
Boozer C,
Blair-West J,
Fidahusein N,
Denton DA,
and
Friedman JM.
Physiological response to long-term peripheral and central leptin infusion in lean and obese mice.
Proc Natl Acad Sci USA
94:
8878-8883,
1997
29.
Havel, PJ,
Uriu-Hare JY,
Liu T,
Stanhope KL,
Stern JS,
Keen CL,
and
Ahrén B.
Marked and rapid decreases of circulating leptin in streptozotocin diabetic rats: reversal by insulin.
Am J Physiol Regulatory Integrative Comp Physiol
274:
R1482-R1491,
1998
30.
Himms-Hagen, J.
Brown adipose tissue metabolism and thermogenesis.
Annu Rev Nutr
5:
69-94,
1985[Web of Science][Medline].
31.
Himms-Hagen, J.
Brown adipose tissue thermogenesis and obesity.
Prog Lipid Res
28:
67-115,
1989[Web of Science][Medline].
32.
Hwa, JJ,
Fawzi AB,
Graziano MP,
Ghibaudi L,
Williams P,
Van Heek M,
Davis H,
Rudinski M,
Sybertz E,
and
Strader CD.
Leptin increases energy expenditure and selectively promotes fat metabolism in ob/ob mice.
Am J Physiol Regulatory Integrative Comp Physiol
272:
R1204-R1209,
1997
33.
Hwa, JJ,
Ghibaudi L,
Compton D,
Fawzi AB,
and
Strader CD.
Intracerebroventricular injection of leptin increases thermogenesis and mobilizes fat metabolism in ob/ob mice.
Horm Metab Res
28:
659-663,
1996[Web of Science][Medline].
34.
Jaburek, M,
Varecha M,
Gimeno RE,
Dembski M,
Jezek P,
Zhang MB,
Burn P,
Tartaglia LA,
and
Garlid KD.
Transport function and regulation of mitochondrial uncoupling proteins 2 and 3.
J Biol Chem
274:
26003-26007,
1999
35.
Klingenberg, M.
Mechanism and evolution of the uncoupling protein of brown adipose tissue.
Trends Biochem Sci
15:
108-112,
1990[Web of Science][Medline].
36.
Kubota, N,
Terauchi Y,
Miki H,
Tamemoto H,
Yamauchi T,
Komeda K,
Satoh S,
Nakano R,
Ishii C,
Sugiyama T,
Eto K,
Tsubamoto Y,
Okuno A,
Murakami K,
Sekihara H,
Hasegawa G,
Naito M,
Toyoshima Y,
Tanaka S,
Shiota K,
Kitamura T,
Fujita T,
Ezaki O,
Aizawa S,
Nagai R,
Tobe K,
Kimura S,
and
Kadowaki T.
PPAR
mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance.
Mol Cell
4:
597-609,
1999[Web of Science][Medline].
37.
Lu, HQ,
Duanmu Z,
Houck C,
Jen KLC,
Buison A,
and
Dunbar JC.
Obesity due to high fat diet decreases the sympathetic nervous and cardiovascular responses to intracerebroventricular leptin in rats.
Brain Res Bull
47:
331-335,
1998[Web of Science][Medline].
38.
Mizuno, TM,
Bergen H,
Funabashi T,
Kleopoulos SP,
Zhong YG,
Bauman WA,
and
Mobbs CV.
Obese gene expression: reduction by fasting and stimulation by insulin and glucose in lean mice, and persistent elevation in acquired (diet-induced) and genetic (yellow agouti) obesity.
Proc Natl Acad Sci USA
93:
3434-3438,
1996
39.
Nicholls, D,
and
Locke R.
Thermogenic mechanisms in brown fat.
Physiol Rev
64:
1-64,
1984
40.
Pelleymounter, MA,
Cullen MJ,
Baker MB,
Hecht R,
Winters D,
Boone T,
and
Collins F.
Effects of the obese gene product on body weight regulation in ob/ob mice.
Science
269:
540-543,
1995
41.
Samec, S,
Seydoux J,
and
Dulloo AG.
Skeletal muscle UCP3 and UCP2 gene expression in response to inhibition of free fatty acid flux through mitochondrial
-oxidation.
Pflügers Arch
438:
452-457,
1999[Web of Science][Medline].
42.
Silva, JE,
and
Rabelo R.
Regulation of the uncoupling protein gene expression.
Eur J Epidemiol
136:
251-264,
1997.
43.
Surwit, RS,
Feinglos MN,
Rodin J,
Sutherland A,
Petro AE,
Opara EC,
Kuhn CM,
and
Rebuffe-Scrive M.
Differential effects of fat and sucrose on the development of obesity and diabetes in C57BL/6J and A/J mice.
Metabolism
44:
645-651,
1995[Web of Science][Medline].
44.
Surwit, RS,
Kuhn CM,
Cochrane C,
McCubbin JA,
and
Feinglos MN.
Diet-induced type II diabetes in C57BL/6J mice.
Diabetes
37:
1163-1167,
1988[Abstract].
45.
Surwit, RS,
Petro AE,
Parekh P,
and
Collins S.
Low plasma leptin in response to dietary fat in diabetes- and obesity-prone mice.
Diabetes
46:
1516-1520,
1997[Abstract].
46.
Surwit, RS,
Seldin MF,
Kuhn CM,
Cochrane C,
and
Feinglos MN.
Control of expression of insulin resistance and hyperglycemia by different genetic factors in diabetic C57BL/6J mice.
Diabetes
40:
82-87,
1991[Abstract].
47.
Surwit, RS,
Wang SY,
Petro AE,
Sanchis D,
Raimbault S,
Ricquier D,
and
Collins S.
Diet-induced changes in uncoupling proteins in obesity-prone and obesity-resistant strains of mice.
Proc Natl Acad Sci USA
95:
4061-4065,
1998
48.
Trayhurn, P,
Duncan JS,
and
Rayner DV.
Acute cold-induced suppression of ob (obese) gene expression in white adipose tissue of mice: mediation by the sympathetic system.
Biochem J
311:
729-733,
1995.
49.
Trayhurn, P,
Duncan JS,
Rayner DV,
and
Hardie LJ.
Rapid inhibition of ob gene expression and circulating leptin levels in lean mice by the
3-adrenoceptor agonists BRL 35135A and ZD2079.
Biochem Biophys Res Commun
228:
605-610,
1996[Web of Science][Medline].
50.
Van Heek, M,
Compton DS,
France CF,
Tedesco RP,
Fawzi AB,
Graziano MP,
Sybertz EJ,
Strader CD,
and
Davis HR, Jr.
Diet-induced obese mice develop peripheral, but not central, resistance to leptin.
J Clin Invest
99:
385-390,
1997[Web of Science][Medline].
51.
Vidal-Puig, A,
Solanes G,
Grujic D,
Flier JS,
and
Lowell BB.
UCP3: an uncoupling protein homologue expressed preferentially and abundantly in skeletal muscle and brown adipose tissue.
Biochem Biophys Res Commun
235:
79-82,
1997[Web of Science][Medline].
52.
Wang, MY,
Lee Y,
and
Unger RH.
Novel form of lipolysis induced by leptin.
J Biol Chem
274:
17541-17544,
1999
53.
Weigle, DS,
Selfridge LE,
Schwartz MW,
Seeley RJ,
Cummings DE,
Havel PJ,
Kuijper JL,
and
BeltrandelRio H.
Elevated free fatty acids induce uncoupling protein 3 expression in muscle
a potential explanation for the effect of fasting.
Diabetes
47:
298-302,
1998[Abstract].
54.
West, DB,
Woguespack J,
and
McCollister S.
Dietary obesity in the mouse: interaction of strain with diet composition.
Am J Physiol Regulatory Integrative Comp Physiol
268:
R658-R665,
1995
55.
Zhang, Y,
Proenca R,
Maffei M,
Barone M,
Leopold L,
and
Friedman JM.
Positional cloning of the mouse obese gene and its human homologue.
Nature
372:
425-432,
1994[Medline].
56.
Zhou, YT,
Shimabukuro M,
Koyama K,
Lee Y,
Wang MY,
Trieu F,
Newgard CB,
and
Unger RH.
Induction by leptin of uncoupling protein-2 and enzymes of fatty acid oxidation.
Proc Natl Acad Sci USA
94:
6386-6390,
1997
This article has been cited by other articles:
![]() |
V. Kus, T. Prazak, P. Brauner, M. Hensler, O. Kuda, P. Flachs, P. Janovska, D. Medrikova, M. Rossmeisl, Z. Jilkova, et al. Induction of muscle thermogenesis by high-fat diet in mice: association with obesity-resistance Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E356 - E367. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Fink, J. A. Herlein, K. Almind, S. Cinti, C. R. Kahn, and W. I. Sivitz Mitochondrial proton leak in obesity-resistant and obesity-prone mice Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2007; 293(5): R1773 - R1780. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kondo, Y. Minegishi, Y. Komine, T. Mori, I. Matsumoto, K. Abe, I. Tokimitsu, T. Hase, and T. Murase Differential regulation of intestinal lipid metabolism-related genes in obesity-resistant A/J vs. obesity-prone C57BL/6J mice Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E1092 - E1099. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gelegen, D. A. Collier, I. C. Campbell, H. Oppelaar, and M. J. H. Kas Behavioral, physiological, and molecular differences in response to dietary restriction in three inbred mouse strains Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E574 - E581. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Kim, T. P. Stewart, W. Zhang, H. Y. Kim, P. M. Nishina, and J. K. Naggert Type 2 diabetes mouse model TallyHo carries an obesity gene on chromosome 6 that exaggerates dietary obesity Physiol Genomics, July 14, 2005; 22(2): 171 - 181. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Bullen Jr, M. Ziotopoulou, L. Ungsunan, J. Misra, I. Alevizos, E. Kokkotou, E. Maratos-Flier, G. Stephanopoulos, and C. S. Mantzoros Short-term resistance to diet-induced obesity in A/J mice is not associated with regulation of hypothalamic neuropeptides Am J Physiol Endocrinol Metab, October 1, 2004; 287(4): E662 - E670. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. CANNON and J. NEDERGAARD Brown Adipose Tissue: Function and Physiological Significance Physiol Rev, January 1, 2004; 84(1): 277 - 359. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Coulter, C. M. Bearden, X. Liu, R. A. Koza, and L. P. Kozak Dietary fat interacts with QTLs controlling induction of Pgc-1{alpha} and Ucp1 during conversion of white to brown fat Physiol Genomics, July 7, 2003; 14(2): 139 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Prpic, P. M. Watson, I. C. Frampton, M. A. Sabol, G. E. Jezek, and T. W. Gettys Adaptive Changes in Adipocyte Gene Expression Differ in AKR/J and SWR/J Mice during Diet-Induced Obesity J. Nutr., November 1, 2002; 132(11): 3325 - 3332. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Surwit, S. Collins, and T. W. Gettys Revisiting Lessons from the C57BL/6J Mouse Am J Physiol Endocrinol Metab, May 1, 2001; 280(5): E825 - E826. [Full Text] [PDF] |
||||
![]() |
S. P. Commins, P. M. Watson, I. C. Frampton, and T. W. Gettys Leptin selectively reduces white adipose tissue in mice via a UCP1-dependent mechanism in brown adipose tissue Am J Physiol Endocrinol Metab, February 1, 2001; 280(2): E372 - E377. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |