Vol. 278, Issue 6, E1031-E1037, June 2000
Peroxynitrite production by TNF-
and IL-1
: implication
for suppression of osteoblastic differentiation
Hisako
Hikiji1,3,
Wee Soo
Shin2,3,
Toshiyuki
Koizumi1,
Tsuyoshi
Takato1,
Takafumi
Susami1,
Yoko
Koizumi1,3,
Yoko
Okai-Matsuo2, and
Teruhiko
Toyo-Oka2,3
1 Department of Oral and Maxillofacial
Surgery, 2 Second Department of Internal
Medicine, Faculty of Medicine, and 3 Health
Service Center, University of Tokyo, Bunkyo-ku, Tokyo 113-8865, Japan
 |
ABSTRACT |
To determine the roles of nitric oxide
(NO) and its metabolite, peroxynitrite (ONOO
), on
osteoblastic activation, we investigated the effects of a NO
donor [ethanamine, 2,2'-(hydroxynitrosohydrazono)bis-
(dNO)], an O
2 donor
(pyrogallol), and an ONOO
scavenger (urate) on
alkaline phosphatase (ALPase) activity and osteocalcin gene expression,
which are indexes of osteoblastic differentiation. dNO elevated ALPase
activity in the osteogenic MC3T3-E1 cell line. The combination of dNO
and pyrogallol reduced both ALPase activity and osteocalcin gene
expression. Because both indexes were recovered by urate,
ONOO
, unlike NO itself, inhibited the osteoblastic
differentiation. Furthermore, treatment with a combination of the
proinflammatory cytokines tumor necrosis factor-
(TNF-
) and
interleukin-1
(IL-1
) was found to yield ONOO
as well as NO and O
2. The reductions
in ALPase activity and osteocalcin gene expression were also restored
by urate. We conclude that ONOO
produced by TNF-
and IL-1
, but not NO per se, would overcome the stimulatory effect
of NO on osteoblastic activity and inhibit osteoblastic differentiation.
nitric oxide; osteoblasts; proinflammatory cytokines
 |
INTRODUCTION |
PEROXYNITRITE (ONOO
), a potent oxidant
produced by the rapid reaction between nitric oxide (NO) and superoxide
(O
2), is formed in an inflammatory
response and causes a variety of toxic effects, including lipid
peroxidation and tyrosine nitration, on several biomolecules (13).
Activated macrophages are reported to synthesize a significant amount
of ONOO
when both NO and
O
2 are simultaneously generated (16).
In vascular tissues, ONOO
may cause oxidant injury
in endothelium (2). In these tissues, NO and
O
2 themselves may react with other
biomolecules, raising questions about their actual toxicities per se.
Little is known about the effects of NO,
O
2, and ONOO
on
bone-forming activity in osteoblasts. We have previously demonstrated that NO stimulates differentiation in primary osteoblasts (12). In
brief, the NO donor sodium nitroprusside (SNP) elevated alkaline phosphatase (ALPase) activity, osteocalcin gene expression, and cGMP
production and reduced PGE2 production. Furthermore, the lowering effect of ALPase activity by cytokines was not caused by
cytokine-induced NO, but rather by another product. ALPase is a
membrane-bound enzyme that is abundant in many tissues. A high level of
ALPase is found in preosteoblasts in bones. From its pattern of gene
expression, ALPase is known to be an early differentiation marker
during the formation of bone (26). Osteocalcin, which is synthesized by
osteoblasts, is present in bone matrix and osteoblasts and is known to
be a differentiation marker at a later stage (26). Therefore, ALPase
and osteocalcin are the most commonly used indexes of osteoblastic
differentiation. Neither the production of
O
2 in osteoblasts nor the action of
ONOO
on osteoblasts has been examined thus far. The
purpose of the present study was to clarify the role of
ONOO
in osteoblastic activity. Therefore, we have
first examined the effects of ONOO
on ALPase
activity as well as on osteocalcin gene expression, the most reliable
indexes of osteoblastic differentiation, using both NO and
O
2 donors that produce
ONOO
(12, 26).
The proinflammatory cytokines, which include tumor necrosis factor-
(TNF-
) and interleukin-1
(IL-1
), are known to enhance bone
resorption (4, 10, 20). We have shown that the bone-resorbing effect of
cytokines is not mediated via NO per se, despite the fact that
cytokines induce the inducible nitric oxide synthase (iNOS) gene and
actual NO production in mouse osteoblasts (12). To analyze the role of
NO, O
2, and ONOO
in
cytokine-stimulated osteoblasts, we then studied whether these cytokines actually stimulate the simultaneous generation of NO and
O
2 and whether the generated NO and
O
2 may develop an even more toxic
product, ONOO
, which would then modify osteoblastic differentiation.
 |
MATERIALS AND METHODS |
Cell culture.
MC3T3-E1 mouse clonal osteogenic cells (a generous gift from Prof. S. Yamamoto, Oh-u University, Japan) were grown in
-MEM (GIBCO, Grand
Island, NY) containing 10% fetal bovine serum (Bioserum, Victoria,
Australia), penicillin, streptomycin, and amphotericin B (Sigma, St.
Louis, MO). The medium was changed every 2-3 days. Conditioned
media used during the last 48 h of incubation were collected for the
nitrate/nitrite assay. Cellular confluence was maintained throughout
all treatment procedures.
Assays of nitrate/nitrite and ALPase in MC3T3-E1 cells.
NO was measured as nitrate/nitrite products in the medium after 48 h of
incubation with or without recombinant TNF-
(10 ng/ml, Dainippon
Pharmaceutical, Tokyo, Japan) and/or IL-1
(10 ng/ml, Genzyme,
Cambridge, MA). Nitrate in the sample was converted to nitrite with
nitrate reductase and then measured by spectrophotometry after Griess
reaction (11). Nitrite levels were normalized by protein amount
measured by Bradford's method (Bio-Rad Laboratories, Hercules, CA).
The level of ALPase expression in bone tissues is closely associated
with osteoblastic differentiation (12, 26). Osteoblasts exposed to
ethanamine, 2,2'-(hydroxynitrosohydrazono)- bis-
[(dNO), Cayman Chemical, Ann Arbor, MI] or cytokines
for 48 h were washed twice with PBS and then lysed in 0.1% Triton X-100. After three cycles of freezing and thawing, an aliquot of
homogenate was assayed for ALPase activity (Wako Pure Chemical Industries, Osaka, Japan). Pyrogallol [(Pgl), Wako Pure Chemical Industries] was applied in the presence of 100 U/ml catalase
(Sigma) to degrade the hydrogen peroxide formed from the dismutation of O
2.
O
2 release assay in MC3T3-E1
cells.
The amount of O
2 released into the
supernatant was assayed by measuring the reduction of ferricytochrome c, as described previously (24). MC3T3-E1 cells were
cultured in 24-well Falcon plates (Lincoln Park, NJ). Ferricytochrome
c (final concentration, 70 µM/l, Sigma) was added to the
buffer (24) at room temperature and incubated for 60 min at 37°C in the presence or absence of superoxide dismutase [(SOD), final concentration 350 U/ml]. The reduction in ferricytochrome
c was measured by spectrophotometry (V-530, JASCO, Tokyo,
Japan). The amount of O
2 release was
calculated from the difference in absorbance with or without SOD
divided by the extinction coefficient for the change of ferricytochrome
c to ferrocytochrome c (E550nm = 21.0 mM
1 · cm
1).
The results are expressed as picomoles per hour per well.
Reverse transcription-polymerase chain reaction.
The osteocalcin message was detected with reverse
transcription-polymerase chain reaction (RT-PCR). dNO in the presence
or absence of Pgl and urate (Wako Pure Chemical Industries) was applied to osteoblasts for 48 h, total RNA was extracted, and the
reverse-transcribed cDNA was severed for the template of PCR (12). The
primer sequences for the osteocalcin gene were (upper),
5'CCTCTCTCTGCTCACTCTGC (57-76) and (lower),
5'GGGCAGCACAGGTCCTAAAT (350-331). The annealing, elongating,
and denaturing conditions for the PCR reaction were 55, 72, and 94°C,
respectively, for a total of 35 cycles with an initial 9-min
denaturation and an additional 7-min extension step at 72°C for
osteocalcin. The reaction products were separated by gel
electrophoresis and stained in ethidium bromide. In another experiment,
TNF-
and IL-1
in the presence or absence of Cu, Zn-SOD (100 U/ml,
Sigma) were applied to the osteoblasts for 48 h. Thereafter, the same
procedure was performed for RT-PCR experiments.
Nitrotyrosine immunocytochemistry.
MC3T3-E1 cells were incubated on 8-well chamber slides (LAB-TEK II,
Nalge Nunc International, Naperville, IL). Medium, with or without
cytokines, was exchanged and cultured for another 48 h. After fixation
with an ethanol-acetone mixture, the cells were treated with
anti-nitrotyrosine polyclonal rabbit antibody (Upstate Biotech, Lake
Placid, NY) at room temperature for 3 h. The cells were then treated
with the biotinylated goat anti-rabbit and the avidin-biotin peroxidase
complex (Vectastain Elite ABC kit, Vector Laboratories, Burlingame,
CA). The immunoproduct was visualized by 3,3'-diaminobenzidine,
as described previously (18), and photographed with a microscope (BH-2,
Olympus, Tokyo, Japan). The level of staining intensity was measured by
densitometry with a graphic software application (Adobe Photoshop,
version 3, Adobe Systems, Mountain View, CA).
Statistics.
All values are expressed as means ± SE. Statistical differences
between the values were examined by one-way ANOVA for multiple comparisons and then Fisher's test. The unpaired t-test was
used to examine statistical differences between two groups. P
values <0.05 were considered significant.
 |
RESULTS |
Effects of a NO donor on the expression of ALPase activity with or
without O
2.
The NO donor dNO was used to examine the direct effect of NO on
osteoblasts (6). MC3T3-E1 cells treated with dNO for 48 h exhibited
ALPase activity that increased in a concentration-dependent manner
(Fig. 1). This result indicates that NO
directly facilitates osteoblastic differentiation. dNO
(10
4 M) increased ALPase activity from
the control level (308.4 ± 11.1 nmol · min
1 · mg
protein
1) to 365.0 ± 16.6 nmol · min
1 · mg
protein
1 (Fig.
2). The combination of dNO
(10
4 M) and the
O
2 donor Pgl
[10
4 M, (28)] reduced ALPase
activity to 216.0 ± 8.9 nmol · min
1 · mg
protein
1. The inhibitory effect of dNO
plus Pgl was attenuated in the presence of the ONOO
scavenger urate [10
4 M, (13,
28)]. These results suggest that the ONOO
formed from NO and O
2 counteracts the
effect of NO alone on ALPase activity in osteoblasts.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1.
Stimulatory effect of nitric oxide (NO) donor ethanamine,
2,2'-(hydroxynitrosohydrazono)bis- (dNO) on alkaline phosphatase
(ALPase) activity in MC3T3-E1 cells. Values are means ± SE; n = 12. * Significant difference (P < 0.002) vs. control
level.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of dNO (10 4 M) or combination of
dNO (10 4 M) and pyrogallol [(Pgl),
10 4 M] on expression of ALPase
activity. Note that urate (10 4 M)
reversed inhibitory effects of combination of dNO and Pgl on ALPase
activity. Values are means ± SE; n = 12. * Significant
difference (P < 0.01) vs. control; # significant
difference (P < 0.01) vs. condition inhibited by dNO plus
Pgl.
|
|
Effects of a NO donor on osteocalcin gene expression with or without
O
2.
Osteocalcin mRNA was constitutively expressed in untreated MC3T3-E1
cells (Fig. 3). A similar level of
expression was observed in cells treated with dNO for 48 h. The gene
expression was reduced when the cells were treated with a combination
of dNO and Pgl (10
4 M). The inhibitory
effect of dNO plus Pgl was reversed by urate (10
4 M), indicating that the
ONOO
formed from NO and
O
2 inhibited osteocalcin gene
expression in osteoblasts.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of osteocalcin mRNA stimulated with dNO
(10 4 M) or combination of dNO
(10 4 M) and Pgl
(10 4 M). Ctl, control; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase. Note that urate
(10 4 M) reversed inhibitory effect of
combined dNO and Pgl. Lane 1, unstimulated osteoblasts;
lane 2, dNO-treated cells; lane 3, cells treated with
combination of dNO and Pgl; lane 4, cells treated with dNO,
Pgl, and urate.
|
|
Effects of cytokines on NO and
O
2 production and ALPase
activity.
Unstimulated MC3T3-E1 cells released a basal amount of NO detected as
nitrate/nitrite (3.1 ± 0.6 nmol/mg protein, Fig.
4A). TNF-
(10 ng/ml) and IL-1
(10 ng/ml) increased NO production to 59.5 ± 2.7 nmol/mg protein
(P < 0.005 vs. control) and 123.4 ± 4.5 nmol/mg protein
(P < 0.0001 vs. control), respectively. Combined TNF-
and
IL-1
markedly enhanced NO production to 432.2 ± 29.9 nmol/mg
protein (P < 0.0001 vs. control, TNF-
alone, or IL-1
alone), indicating the existence of a synergistic interaction between
the two cytokines. This increased NO production was attenuated by
NG-monomethyl-L-arginine
(L-NMMA) (10
4 M)
pretreatment to 259.8 ± 9.2 nmol/mg protein (P < 0.0001 vs. TNF-
+ IL-1
, Fig. 4A).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4.
A: stimulatory effects of tumor necrosis factor- (TNF- ),
interleukin-1 (IL-1 ), combination of TNF- plus IL-1 , and
inhibitory effect of
NG-monomethyl-L-arginine
(L-NMMA) on NO production. B: inhibitory effects of
TNF- and IL-1 on ALPase activity with or without
L-NMMA in osteoblasts. Values are means ± SE; n = 12. * Significant difference (P < 0.005) vs. control;
# significant difference (P < 0.005) vs. condition
stimulated by TNF- plus IL-1 .
|
|
TNF-
, IL-1
, and combined TNF-
and IL-1
reduced ALPase
activity in osteoblasts from the control level of 300.3 ± 21.2 nmol · min
1 · mg
protein
1 to 77.8 ± 7.6, 73.5 ± 3.6, and 47.7 ± 2.0 nmol · min
1 · mg
protein
1, respectively (Fig.
4B). However, L-NMMA did not reverse the cytokine-induced ALPase reduction (52.1 ± 1.5 nmol · min
1 · mg
protein
1). The reduction in ALPase
activity by cytokines exhibited a clear contrast with the increase in
ALPase activity by dNO (Fig. 1). Thus the decrease in ALPase activity
caused by cytokines might not be due to the production of
cytokine-induced NO, which is compatible with our previous findings in
mouse primary osteoblasts (12).
O
2 was not detected in MC3T3-E1 cells
before stimulation by the cytokines (Fig.
5). Administration of TNF-
(10 ng/ml) or
IL-1
(10 ng/ml) alone did not stimulate the cells to produce
O
2. Combined TNF-
and IL-1
induced a significant amount of O
2
production (293.8 ± 48.5 pmol · h
1 · well
1,
P < 0.0002). Any cytokine or
NO/O
2 donor at the concentrations used
in this study did not affect cell viability with respect to cell
number, trypan blue exclusion, and the reduction of
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (data not
shown).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 5.
Stimulatory effects of TNF- and IL-1 on
O 2 production. Values are means ± SE; n = 6. * Significant difference (P < 0.01)
vs. Ctl.
|
|
Effects of SOD on cytokine-induced reduction of ALPase activity
and osteocalcin gene expression.
Cytokine treatment reduced ALPase activity from 301.7 ± 7.3 to
68.7 ± 1.6 nmol · min
1 · mg
protein
1 (P < 0.0001, Fig. 6). SOD partly reversed the
reduction of cytokine-induced ALPase activity to 84.9 ± 3.6 nmol · min
1 · mg
protein
1 (P < 0.02, Fig. 6).
Urate restored more significantly the decrease in cytokine-induced
ALPase activity (205.0 ± 13.3 nmol · min
1 · mg
protein
1). RT-PCR demonstrated that
coadministration of TNF-
and IL-1
reduced the gene expression of
osteocalcin from the control level; SOD reversed the reduced gene
expression of osteocalcin (Fig. 7).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of superoxide dismutase (SOD, 100 U/ml) or urate
(10 4 M) on reduction of ALPase activity
induced by TNF- and IL-1 . Note that SOD and urate reversed
inhibitory effects of combined TNF- and IL-1 on ALPase activity.
Values are means ± SE; n = 12. * Significant difference
(P < 0.02) vs. control; # significant difference
(P < 0.02) vs. condition inhibited by TNF- + IL-1 .
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 7.
Expression of osteocalcin mRNA stimulated with combination of TNF-
and IL-1 . Note that SOD reversed inhibitory effect of combined
TNF- and IL-1 . Lane 1, unstimulated osteoblasts; lane
2, cells treated with combination of TNF- and IL-1 ; lane
3, cells treated with TNF- , IL-1 , and SOD.
|
|
Immunodetection of ONOO
by use of
anti-nitrotyrosine antibody.
The action of ONOO
can be detected by the
measurement of nitrotyrosine, which represents nitrosylation of
cellular protein by ONOO
(3). Nitrotyrosine residues
on protein are stable markers of ONOO
synthesis (3,
13). MC3T3-E1 cells showed weak nitrotyrosine expression without the
addition of any chemical (Fig. 8). The combined effect of NO and O
2 produced
by dNO and Pgl elevated the level of nitrotyrosine (Fig. 8). These
results directly indicate that the administration of NO and
O
2 produced ONOO
.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 8.
Immunocytochemistry of nitrotyrosine in osteoblasts after application
of NO and O 2 donors. Values are means ± SE; n = 3. * Significant difference (P < 0.002) vs. negative control [(Nega), without antinitrotyrosine
antibody]; # significant difference (P < 0.002) vs.
control [(Cont), without NO/O 2
donors].
|
|
TNF-
(10 ng/ml) or IL-1
(10 ng/ml) alone did not increase
nitrotyrosine production (Fig.
9), whereas combined
TNF-
and IL-1
enhanced the production of nitrotyrosine. These
data suggest that osteoblasts stimulated with TNF-
and IL-1
produce more ONOO
than untreated or single
cytokine-treated cells.

View larger version (137K):
[in this window]
[in a new window]
|
Fig. 9.
Immunocytochemistry of nitrotyrosine in osteoblasts after
proinflammatory cytokine application. A: negative control;
B: unstimulated control; C: TNF- alone; D:
IL-1 alone; E: TNF- plus IL-1 . Note that the
combination of TNF- and IL-1 enhanced basal production of
nitrotyrosine. Bar length, 100 µm.
|
|
 |
DISCUSSION |
NO has significant effects on bone metabolism (8). We have previously
demonstrated that NO directly facilitated osteoblastic differentiation
and that it was not responsible for the cytokine-induced inhibition of
osteoblastic activity in mouse primary culture (12). What is the cause
of the inhibition of osteoblastic activity, even though a sufficient
amount of NO is formed in the presence of TNF-
and IL-1
? In
addition to NO, other more reactive and toxic substances may be formed
in cytokine-stimulated osteoblasts, as presented in Fig.
10. In this investigation, we found that
ONOO
synthesized in cytokine-treated cells overcame
the stimulatory effect of NO per se (12) on osteoblastic
differentiation.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 10.
Metabolic pathway of NO-related radicals. dNO and Pgl produce NO and
O 2, respectively. NO in presence of
O 2 forms a new radical,
ONOO , and ONOO is scavenged by
urate. Note that the combination of TNF- and IL-1 has a
stimulatory effect on NO and O 2
production. L-NMMA inhibits NO production from
L-arginine by inducible NO synthase (iNOS).
|
|
NO reacts with O
2 to form the highly
reactive intermediate ONOO
(2, 16, 24). First, we
examined the effects of ONOO
on osteoblastic
differentiation by use of oxygen radical donors and the specific free
radical scavengers. The simultaneous administration of an NO donor
(dNO) and an O
2 donor (Pgl) was found
to produce ONOO
and inhibit osteoblastic
differentiation (Figs. 2 and 3) without affecting cell viability. The
inhibitory effects of the NO and O
2
donors on osteoblastic differentiation were reversed by urate, a potent
and selective ONOO
scavenger (13). These results
suggest that the ONOO
formed from NO and
O
2 inhibited the osteoblastic differentiation.
Proinflammatory cytokines enhance bone resorption (4, 10, 20). IL-1
and IL-1
are the most powerful stimulators of bone resorption (14).
Two- to threefold inhibition of osteocalcin synthesis by TNF-
and
IL-1
has been reported in osteoblasts (7, 25). Reduced expression of
the osteocalcin gene by TNF-
and IL-1
was observed in the present
study (Fig. 7). TNF-
and IL-1
have also reduced ALPase activity
in osteoblasts (12, Fig. 4). Therefore, these cytokines have an
inhibitory effect on osteoblastic differentiation. Because
ONOO
produced from NO and
O
2 has shown a suppressive effect on
the differentiation of the cytokine-treated osteoblasts, the next step
to be clarified is whether cytokine-stimulated osteoblasts actually
produce both NO and O
2. TNF-
or
IL-1
alone or their combination yielded NO production (Fig. 4). In addition, the cytokine cotreatment also enhanced the production of
O
2, although
O
2 was not detected on application of
only one cytokine (Fig. 5). Finally, we have verified that simultaneous
generation of both NO and O
2 by
TNF-
and IL-1
leads to ONOO
formation (Fig.
8). ONOO
formed from NO and
O
2 in these cells would nullify the
stimulatory effect of NO and might even suppress osteoblastic differentiation.
There was no measurable restoration of ALPase activity by
L-NMMA in the presence of cytokines. One reason that
L-NMMA could not restore ALPase activity is that
cytokine-induced O
2 alone suppressed
the enzyme activity. This was partly ascertained by the experiment with
SOD in conjunction with cytokines. SOD modestly but significantly
restored both ALPase activity and osteocalcin gene expression (Fig. 6).
However, the recovery of ALPase activity by SOD was not sufficient,
suggesting that O
2 synthesis alone may
not fully explain cytokine-induced ALPase reduction.
The rate constant for ONOO
formation from NO and
O
2 is 6.7 × 109
M
1 · s
1
(21), whereas the rate constant for the scavenging of
O
2 by SOD is 2.5 × 109
M
1 · s
1
(21). Therefore, the coexistence of NO and
O
2 produced by the cytokine
stimulation could form some amount of ONOO
even in
the presence of SOD (17, 27). The produced ONOO
may
participate in the reduction of ALPase activity much more than
cytokine-induced O
2. Urate, an
ONOO
scavenger, restored the cytokine-induced
reduction of ALPase activity more markedly than SOD (Fig. 6). A similar
argument could also be made for a continued production of NO at a low
level even after L-NMMA preincubation.
O
2 produced by the cytokine
stimulation may react rapidly with NO, forming ONOO
even in the presence of L-NMMA, a competitive inhibitor of
NOS activity. This would explain the reason that ALPase activity
remains depressed even in the supposed absence of NO (Fig. 4). Although the reduction of ALPase activity by cytokine cannot be fully explained by the action of ONOO
alone, most of the causes may
be attributed to the effects of ONOO
production.
Single cytokines produced NO and did not produce O
2 (Figs. 4 and 5). Without a
superoxide source, single cytokine stimulation would not produce
ONOO
, yet single cytokines could inhibit ALPase
activity. There may be alternate sources of
O
2, such as mitochondrial respiration
(23).
Damoulis and Hauschka (5) demonstrated that the NO donor
S-nitroso-acetyl-penicillamine (SNAP) at a higher concentration (10
3 M) evoked cell death in MC3T3-E1
cells after long-term culture
73 h. Because SNAP has a half-life of 5 h at pH 7 and 37°C (15), NO produced by SNAP would affect cell
viability in the first several hours of incubation. The concentration
of SNAP they employed may be toxic or lethal to MC3T3-E1 cells. At the
same time, dNO at a lower concentration and a longer half-life
[40 h at pH 7.4 and 37°C, (6)] would be less harmful to
the cells. In our study, NO produced from dNO at a submillimolar
concentration could exert the biological effects during the entire
incubation period. NO donors with a different half-life and
concentration may cause the altered effects on osteoblasts. Damoulis
and Hauschka have also shown that mouse TNF-
at 20 ng/ml combined
with mouse IL-1
at 5 IU/ml produced NO and reduced cell viability,
although mouse TNF-
at 1 ng/ml with IL-1
had no cytotoxic effect.
As they mentioned, mouse TNF-
is more cytotoxic than human TNF-
,
and mouse TNF-
at 20 ng/ml has a cytotoxic effect independent of NO.
In our investigation, human TNF-
at 10 ng/ml with human IL-1
at
10 ng/ml produced NO and reduced ALPase activity in osteoblasts,
although it had no effect on cell viability (data not shown). Thus the
action of TNF-
depends on the species and the concentration in the osteoblasts.
In a previous study, we were the first to demonstrate endothelial cell
nitric oxide synthase (ecNOS) expression in osteoblasts (12). The
constitutive production of NO may regulate osteoblast growth (8) and
contribute to bone formation by mechanical stimulation (9). Fox et al.
(9) have reported that administration of L-NMMA prevented
the increase in bone formation by mechanical stimulation and concluded
that ecNOS was responsible for the NO production. NO produced by ecNOS
would be a physiological mediator of estrogen action on bone (1, 19).
Estrogen deficiency might reduce the level of NO, ALPase production,
and osteocalcin gene expression. Therefore, the physiological level of
NO produced by ecNOS is expected to prevent the progress of
osteoporosis. A large amount of O
2
would not be formed under the condition where ecNOS constitutively
produced NO. In contrast, under the inflammatory conditions, not only
NO from iNOS but also O
2 are produced
by proinflammatory cytokines, as we demonstrated. In osteoarthritis,
TNF-
, IL-1
, and iNOS were highly expressed in synovial cells
(22). The collaboration of these two cytokines may lead to
ONOO
production, as is shown in the present report.
Accordingly, ONOO
may be one of the most effective
NO metabolites in cytokine-stimulated osteoblasts. In conclusion,
ONOO
produced by TNF-
and IL-1
, but not NO per
se, would overcome the stimulatory effect of NO on osteoblastic
activity and inhibit osteoblastic differentiation.
 |
ACKNOWLEDGEMENTS |
We appreciate Chieko Hemmi for skillful assistance.
 |
FOOTNOTES |
Part of this work was financially supported by a grand-in-aid for
scientific research from the Ministry of Education, Science, and
Culture and the Ministry of Health and Welfare, the Japan Foundation
for Osteoporosis, and the Sankyo Foundation for Life Sciences and
Sharyo Zaidan.
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: H. Hikiji,
Department of Oral and Maxillofacial Surgery, Faculty of Medicine,
University of Tokyo, 7-3-1, Hongo, Bunkyo-ku 113-8655, Tokyo, Japan.
Received 2 June 1999; accepted in final form 5 January 2000.
 |
REFERENCES |
1.
Armour, KE,
and
Ralston SH.
Estrogen upregulates endothelial constitutive nitric oxide synthase expression in human osteoblast-like cells.
Endocrinology
139:
799-802,
1998[Abstract/Free Full Text].
2.
Beckman, JS,
Beckman TW,
Chen J,
Marshall PA,
and
Freeman BA.
Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide.
Proc Natl Acad Sci USA
87:
1620-1624,
1990[Abstract/Free Full Text].
3.
Beckman, JS,
Ye YZ,
Anderson PG,
Chen J,
Accavitti MA,
Tarpey MM,
and
White CR.
Extensive nitration of protein tyrosines in human atherosclerosis detected by immunohistochemistry.
Biol Chem Hoppe Syler
375:
81-88,
1994[Web of Science][Medline].
4.
Bertolini, DR,
Nedwin GE,
Bringman TS,
Smith DD,
and
Mundy GR.
Simulation of bone resorption and inhibition of bone formation in vitro by human tumour necrosis factors.
Nature
319:
516-518,
1986[Medline].
5.
Damoulis, PD,
and
Hauschka PV.
Nitric oxide acts in conjunction with proinflammatory cytokines to promote cell death in osteoblasts.
J Bone Miner Res
12:
412-422,
1997[Web of Science][Medline].
6.
Estévez, AG,
Spear N,
Pelluffo H,
Kamaid A,
Barbeito L,
and
Beckman JS.
Examining apoptosis in cultured cells after exposure of nitric oxide and peroxynitrite.
In: Methods in Enzymology. San Diego, CA: Academic, 1999, vol. 301, p. 393-402.
7.
Evans, DB,
Thavarajah M,
and
Kanis JA.
Involvement of prostaglandin E2 in the inhibition of osteocalcin synthesis by human osteoblast-like cells in response to cytokines and systemic hormones.
Biochem Biophys Res Commun
167:
194-202,
1990[Web of Science][Medline].
8.
Evans, DM,
and
Ralston SH.
Nitric oxide and bone.
J Bone Miner Res
11:
300-305,
1996[Web of Science][Medline].
9.
Fox, SW,
Chambers TJ,
and
Chow JWM
Nitric oxide is an early mediator of the increase in bone formation by mechanical stimulation.
Am J Physiol
33:
E955-E960,
1996.
10.
Gowen, M,
Wood DD,
Ihrie EJ,
McGuire MKB,
and
Russell RGG
An interleukin 1 like factor stimulates bone resorption in vitro.
Nature
306:
378-380,
1983[Medline].
11.
Green, LC,
Wagner DA,
Glogowski J,
Skipper PL,
Wishnok JS,
and
Tannenbaum SR.
Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids.
Anal Biochem
126:
131-138,
1982[Web of Science][Medline].
12.
Hikiji, H,
Shin WS,
Oida S,
Takato T,
Koizumi Y,
and
Toyo-oka T.
Direct action of nitric oxide on osteoblastic differentiation.
FEBS Lett
410:
238-242,
1997[Web of Science][Medline].
13.
Hooper, DC,
Spitsin S,
Kean RB,
Champion JM,
Dickson GM,
Chaudhry I,
and
Koprowski H.
Uric acid, a natural scavenger of peroxynitrite, in experimental allergic encephalomyelitis and multiple sclerosis.
Proc Natl Acad Sci USA
95:
675-680,
1998[Abstract/Free Full Text].
14.
Horowitz, MC,
and
Lorenzo JA.
Local regulators of bone: IL-1, TNF, lymphotoxin, interferon-
, IL-8, IL-10, IL-4, the LIF/IL-6 family, and additional cytokines.
In: Principles of Bone Biology. San Diego, CA: Academic, 1996, p. 687-700.
15.
Hou, Y,
Wang J,
Ramirez J,
and
Wang PG.
Glyco-S-nitrosothiols: sugar-SNAP, a new type of nitric oxide donor.
In: Methods in Enzymology. San Diego,CA: Academic, 1999, vol. 301, p. 242-249.
16.
Ischiropoulos, H,
Zhu L,
and
Beckman JS.
Peroxynitrite formation from macrophage-derived nitric oxide.
Arch Biochem Biophys
298:
446-451,
1992[Web of Science][Medline].
17.
Ischiropoulos, H,
Zhu L,
Chen J,
Tsai M,
Martin JC,
Smith CD,
and
Beckman JS.
Peroxynitrite-mediated tyrosine nitration catalyzed by superoxide dismutase.
Arch Biochem Biophys
298:
431-437,
1992[Web of Science][Medline].
18.
Kawaguchi, H,
Shin WS,
Wang Y,
Inukai M,
Kato M,
Matsuo-Okai Y,
Sakamoto A,
Uehara Y,
Kaneda Y,
and
Toyo-oka T.
In vivo gene transfection of human endothelial cell nitric oxide synthase in cardiomyocytes causes apoptosis-like cell death. Identification using sendai virus-coated liposomes.
Circulation
95:
2441-2447,
1997[Abstract/Free Full Text].
19.
Kleinert, H,
Wallerath T,
Euchenhofer C,
Ihrig-Biedert I,
Li H,
and
Forstermann U.
Estrogens increase transcription of the human endothelial NO synthase gene. Analysis of the transcription factors involved.
Hypertension
31:
582-588,
1998[Abstract/Free Full Text].
20.
Lader, CS,
and
Flanagan AM.
Prostaglandin E2, interleukin 1
and tumor necrosis factor-
increase human osteoclast formation and bone resorption in vitro.
Endocrinology
139:
3157-3164,
1998[Abstract/Free Full Text].
21.
Lewis, RS,
Tamir S,
Tannenbaum SR,
and
Deen WM.
Kinetic analysis of the fate of nitric oxide synthesized by macrophages in vitro.
J Biol Chem
270:
29350-29355,
1995[Abstract/Free Full Text].
22.
Melchiorri, C,
Meliconi R,
Frizziero L,
Silvestri T,
Pulsatelli L,
Mazzetti I,
Borzi RM,
Uguccioni M,
and
Facchini A.
Enhanced and coordinated in vivo expression of inflammatory cytokines and nitric oxide synthase by chondrocytes from patients with osteoarthritis.
Arthritis Rheum
41:
2165-2174,
1998[Web of Science][Medline].
23.
Poderoso, JJ,
Peralta JG,
Lisdero CL,
Carreras MC,
Radisic M,
Schöpfer F,
Cadenas E,
and
Boveris A.
Nitric oxide regulates oxygen uptake and hydrogen peroxide release by the isolated beating rat heart.
Am J Physiol Cell Physiol
274:
C112-C119,
1998[Abstract/Free Full Text].
24.
Szabó, C,
Zingarelli B,
and
Salzman AL.
Role of poly-ADP ribosyltransferase activation in the vascular contractile and energetic failure elicited by exogenous and endogenous nitric oxide and peroxynitrite.
Circ Res
78:
1051-1063,
1996[Abstract/Free Full Text].
25.
Taichman, RS,
and
Hauschka PV.
Effects of interleukin-1
and tumor necrosis factor-
on osteoblastic expression of osteocalcin and mineralized extracellular matrix in vitro.
Inflammation
16:
587-601,
1992[Web of Science][Medline].
26.
Weinreb, M,
Shinar D,
and
Rodan GA.
Different pattern of alkaline phosphatase, osteopontin, and osteocalcin expression in developing rat bone visualized by in situ hybridization.
J Bone Miner Res
5:
831-842,
1990[Web of Science][Medline].
27.
White, CR,
Brock TA,
Chang L,
Crapo J,
Briscoe P,
Ku D,
Bradley WA,
Gianturco SH,
Gore J,
Freeman BA,
and
Tarpey MM.
Superoxide and peroxynitrite in atherosclerosis.
Proc Natl Acad Sci USA
91:
1044-1048,
1994[Abstract/Free Full Text].
28.
Xie, Y,
and
Wolin MS.
Role of nitric oxide and its interaction with superoxides in the suppression of cardiac muscle mitochondrial respiration: involvement in response to hypoxia/reoxygenation.
Circulation
94:
2580-2586,
1996[Abstract/Free Full Text].
Am J Physiol Endocrinol Metab 278(6):E1031-E1037
0193-1849/00 $5.00
Copyright © 2000 the American Physiological Society