AJP - Endo Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 278: E1031-E1037, 2000;
0193-1849/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hikiji, H.
Right arrow Articles by Toyo-Oka, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hikiji, H.
Right arrow Articles by Toyo-Oka, T.
Vol. 278, Issue 6, E1031-E1037, June 2000

Peroxynitrite production by TNF-alpha and IL-1beta : implication for suppression of osteoblastic differentiation

Hisako Hikiji1,3, Wee Soo Shin2,3, Toshiyuki Koizumi1, Tsuyoshi Takato1, Takafumi Susami1, Yoko Koizumi1,3, Yoko Okai-Matsuo2, and Teruhiko Toyo-Oka2,3

1 Department of Oral and Maxillofacial Surgery, 2 Second Department of Internal Medicine, Faculty of Medicine, and 3 Health Service Center, University of Tokyo, Bunkyo-ku, Tokyo 113-8865, Japan


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

To determine the roles of nitric oxide (NO) and its metabolite, peroxynitrite (ONOO-), on osteoblastic activation, we investigated the effects of a NO donor [ethanamine, 2,2'-(hydroxynitrosohydrazono)bis- (dNO)], an O-2 donor (pyrogallol), and an ONOO- scavenger (urate) on alkaline phosphatase (ALPase) activity and osteocalcin gene expression, which are indexes of osteoblastic differentiation. dNO elevated ALPase activity in the osteogenic MC3T3-E1 cell line. The combination of dNO and pyrogallol reduced both ALPase activity and osteocalcin gene expression. Because both indexes were recovered by urate, ONOO-, unlike NO itself, inhibited the osteoblastic differentiation. Furthermore, treatment with a combination of the proinflammatory cytokines tumor necrosis factor-alpha (TNF-alpha ) and interleukin-1beta (IL-1beta ) was found to yield ONOO- as well as NO and O-2. The reductions in ALPase activity and osteocalcin gene expression were also restored by urate. We conclude that ONOO- produced by TNF-alpha and IL-1beta , but not NO per se, would overcome the stimulatory effect of NO on osteoblastic activity and inhibit osteoblastic differentiation.

nitric oxide; osteoblasts; proinflammatory cytokines


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

PEROXYNITRITE (ONOO-), a potent oxidant produced by the rapid reaction between nitric oxide (NO) and superoxide (O-2), is formed in an inflammatory response and causes a variety of toxic effects, including lipid peroxidation and tyrosine nitration, on several biomolecules (13). Activated macrophages are reported to synthesize a significant amount of ONOO- when both NO and O-2 are simultaneously generated (16). In vascular tissues, ONOO- may cause oxidant injury in endothelium (2). In these tissues, NO and O-2 themselves may react with other biomolecules, raising questions about their actual toxicities per se.

Little is known about the effects of NO, O-2, and ONOO- on bone-forming activity in osteoblasts. We have previously demonstrated that NO stimulates differentiation in primary osteoblasts (12). In brief, the NO donor sodium nitroprusside (SNP) elevated alkaline phosphatase (ALPase) activity, osteocalcin gene expression, and cGMP production and reduced PGE2 production. Furthermore, the lowering effect of ALPase activity by cytokines was not caused by cytokine-induced NO, but rather by another product. ALPase is a membrane-bound enzyme that is abundant in many tissues. A high level of ALPase is found in preosteoblasts in bones. From its pattern of gene expression, ALPase is known to be an early differentiation marker during the formation of bone (26). Osteocalcin, which is synthesized by osteoblasts, is present in bone matrix and osteoblasts and is known to be a differentiation marker at a later stage (26). Therefore, ALPase and osteocalcin are the most commonly used indexes of osteoblastic differentiation. Neither the production of O-2 in osteoblasts nor the action of ONOO- on osteoblasts has been examined thus far. The purpose of the present study was to clarify the role of ONOO- in osteoblastic activity. Therefore, we have first examined the effects of ONOO- on ALPase activity as well as on osteocalcin gene expression, the most reliable indexes of osteoblastic differentiation, using both NO and O-2 donors that produce ONOO- (12, 26).

The proinflammatory cytokines, which include tumor necrosis factor-alpha (TNF-alpha ) and interleukin-1beta (IL-1beta ), are known to enhance bone resorption (4, 10, 20). We have shown that the bone-resorbing effect of cytokines is not mediated via NO per se, despite the fact that cytokines induce the inducible nitric oxide synthase (iNOS) gene and actual NO production in mouse osteoblasts (12). To analyze the role of NO, O-2, and ONOO- in cytokine-stimulated osteoblasts, we then studied whether these cytokines actually stimulate the simultaneous generation of NO and O-2 and whether the generated NO and O-2 may develop an even more toxic product, ONOO-, which would then modify osteoblastic differentiation.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. MC3T3-E1 mouse clonal osteogenic cells (a generous gift from Prof. S. Yamamoto, Oh-u University, Japan) were grown in alpha -MEM (GIBCO, Grand Island, NY) containing 10% fetal bovine serum (Bioserum, Victoria, Australia), penicillin, streptomycin, and amphotericin B (Sigma, St. Louis, MO). The medium was changed every 2-3 days. Conditioned media used during the last 48 h of incubation were collected for the nitrate/nitrite assay. Cellular confluence was maintained throughout all treatment procedures.

Assays of nitrate/nitrite and ALPase in MC3T3-E1 cells. NO was measured as nitrate/nitrite products in the medium after 48 h of incubation with or without recombinant TNF-alpha (10 ng/ml, Dainippon Pharmaceutical, Tokyo, Japan) and/or IL-1beta (10 ng/ml, Genzyme, Cambridge, MA). Nitrate in the sample was converted to nitrite with nitrate reductase and then measured by spectrophotometry after Griess reaction (11). Nitrite levels were normalized by protein amount measured by Bradford's method (Bio-Rad Laboratories, Hercules, CA). The level of ALPase expression in bone tissues is closely associated with osteoblastic differentiation (12, 26). Osteoblasts exposed to ethanamine, 2,2'-(hydroxynitrosohydrazono)- bis- [(dNO), Cayman Chemical, Ann Arbor, MI] or cytokines for 48 h were washed twice with PBS and then lysed in 0.1% Triton X-100. After three cycles of freezing and thawing, an aliquot of homogenate was assayed for ALPase activity (Wako Pure Chemical Industries, Osaka, Japan). Pyrogallol [(Pgl), Wako Pure Chemical Industries] was applied in the presence of 100 U/ml catalase (Sigma) to degrade the hydrogen peroxide formed from the dismutation of O-2.

O-2 release assay in MC3T3-E1 cells. The amount of O-2 released into the supernatant was assayed by measuring the reduction of ferricytochrome c, as described previously (24). MC3T3-E1 cells were cultured in 24-well Falcon plates (Lincoln Park, NJ). Ferricytochrome c (final concentration, 70 µM/l, Sigma) was added to the buffer (24) at room temperature and incubated for 60 min at 37°C in the presence or absence of superoxide dismutase [(SOD), final concentration 350 U/ml]. The reduction in ferricytochrome c was measured by spectrophotometry (V-530, JASCO, Tokyo, Japan). The amount of O-2 release was calculated from the difference in absorbance with or without SOD divided by the extinction coefficient for the change of ferricytochrome c to ferrocytochrome c (E550nm = 21.0 mM-1 · cm-1). The results are expressed as picomoles per hour per well.

Reverse transcription-polymerase chain reaction. The osteocalcin message was detected with reverse transcription-polymerase chain reaction (RT-PCR). dNO in the presence or absence of Pgl and urate (Wako Pure Chemical Industries) was applied to osteoblasts for 48 h, total RNA was extracted, and the reverse-transcribed cDNA was severed for the template of PCR (12). The primer sequences for the osteocalcin gene were (upper), 5'CCTCTCTCTGCTCACTCTGC (57-76) and (lower), 5'GGGCAGCACAGGTCCTAAAT (350-331). The annealing, elongating, and denaturing conditions for the PCR reaction were 55, 72, and 94°C, respectively, for a total of 35 cycles with an initial 9-min denaturation and an additional 7-min extension step at 72°C for osteocalcin. The reaction products were separated by gel electrophoresis and stained in ethidium bromide. In another experiment, TNF-alpha and IL-1beta in the presence or absence of Cu, Zn-SOD (100 U/ml, Sigma) were applied to the osteoblasts for 48 h. Thereafter, the same procedure was performed for RT-PCR experiments.

Nitrotyrosine immunocytochemistry. MC3T3-E1 cells were incubated on 8-well chamber slides (LAB-TEK II, Nalge Nunc International, Naperville, IL). Medium, with or without cytokines, was exchanged and cultured for another 48 h. After fixation with an ethanol-acetone mixture, the cells were treated with anti-nitrotyrosine polyclonal rabbit antibody (Upstate Biotech, Lake Placid, NY) at room temperature for 3 h. The cells were then treated with the biotinylated goat anti-rabbit and the avidin-biotin peroxidase complex (Vectastain Elite ABC kit, Vector Laboratories, Burlingame, CA). The immunoproduct was visualized by 3,3'-diaminobenzidine, as described previously (18), and photographed with a microscope (BH-2, Olympus, Tokyo, Japan). The level of staining intensity was measured by densitometry with a graphic software application (Adobe Photoshop, version 3, Adobe Systems, Mountain View, CA).

Statistics. All values are expressed as means ± SE. Statistical differences between the values were examined by one-way ANOVA for multiple comparisons and then Fisher's test. The unpaired t-test was used to examine statistical differences between two groups. P values <0.05 were considered significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Effects of a NO donor on the expression of ALPase activity with or without O-2. The NO donor dNO was used to examine the direct effect of NO on osteoblasts (6). MC3T3-E1 cells treated with dNO for 48 h exhibited ALPase activity that increased in a concentration-dependent manner (Fig. 1). This result indicates that NO directly facilitates osteoblastic differentiation. dNO (10-4 M) increased ALPase activity from the control level (308.4 ± 11.1 nmol · min-1 · mg protein-1) to 365.0 ± 16.6 nmol · min-1 · mg protein-1 (Fig. 2). The combination of dNO (10-4 M) and the O-2 donor Pgl [10-4 M, (28)] reduced ALPase activity to 216.0 ± 8.9 nmol · min-1 · mg protein-1. The inhibitory effect of dNO plus Pgl was attenuated in the presence of the ONOO- scavenger urate [10-4 M, (13, 28)]. These results suggest that the ONOO- formed from NO and O-2 counteracts the effect of NO alone on ALPase activity in osteoblasts.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Stimulatory effect of nitric oxide (NO) donor ethanamine, 2,2'-(hydroxynitrosohydrazono)bis- (dNO) on alkaline phosphatase (ALPase) activity in MC3T3-E1 cells. Values are means ± SE; n = 12. * Significant difference (P < 0.002) vs. control level.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of dNO (10-4 M) or combination of dNO (10-4 M) and pyrogallol [(Pgl), 10-4 M] on expression of ALPase activity. Note that urate (10-4 M) reversed inhibitory effects of combination of dNO and Pgl on ALPase activity. Values are means ± SE; n = 12. * Significant difference (P < 0.01) vs. control; # significant difference (P < 0.01) vs. condition inhibited by dNO plus Pgl.

Effects of a NO donor on osteocalcin gene expression with or without O-2. Osteocalcin mRNA was constitutively expressed in untreated MC3T3-E1 cells (Fig. 3). A similar level of expression was observed in cells treated with dNO for 48 h. The gene expression was reduced when the cells were treated with a combination of dNO and Pgl (10-4 M). The inhibitory effect of dNO plus Pgl was reversed by urate (10-4 M), indicating that the ONOO- formed from NO and O-2 inhibited osteocalcin gene expression in osteoblasts.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Expression of osteocalcin mRNA stimulated with dNO (10-4 M) or combination of dNO (10-4 M) and Pgl (10-4 M). Ctl, control; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Note that urate (10-4 M) reversed inhibitory effect of combined dNO and Pgl. Lane 1, unstimulated osteoblasts; lane 2, dNO-treated cells; lane 3, cells treated with combination of dNO and Pgl; lane 4, cells treated with dNO, Pgl, and urate.

Effects of cytokines on NO and O-2 production and ALPase activity. Unstimulated MC3T3-E1 cells released a basal amount of NO detected as nitrate/nitrite (3.1 ± 0.6 nmol/mg protein, Fig. 4A). TNF-alpha (10 ng/ml) and IL-1beta (10 ng/ml) increased NO production to 59.5 ± 2.7 nmol/mg protein (P < 0.005 vs. control) and 123.4 ± 4.5 nmol/mg protein (P < 0.0001 vs. control), respectively. Combined TNF-alpha and IL-1beta markedly enhanced NO production to 432.2 ± 29.9 nmol/mg protein (P < 0.0001 vs. control, TNF-alpha alone, or IL-1beta alone), indicating the existence of a synergistic interaction between the two cytokines. This increased NO production was attenuated by NG-monomethyl-L-arginine (L-NMMA) (10-4 M) pretreatment to 259.8 ± 9.2 nmol/mg protein (P < 0.0001 vs. TNF-alpha  + IL-1beta , Fig. 4A).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   A: stimulatory effects of tumor necrosis factor-alpha (TNF-alpha ), interleukin-1beta (IL-1beta ), combination of TNF-alpha plus IL-1beta , and inhibitory effect of NG-monomethyl-L-arginine (L-NMMA) on NO production. B: inhibitory effects of TNF-alpha and IL-1beta on ALPase activity with or without L-NMMA in osteoblasts. Values are means ± SE; n = 12. * Significant difference (P < 0.005) vs. control; # significant difference (P < 0.005) vs. condition stimulated by TNF-alpha plus IL-1beta .

TNF-alpha , IL-1beta , and combined TNF-alpha and IL-1beta reduced ALPase activity in osteoblasts from the control level of 300.3 ± 21.2 nmol · min-1 · mg protein-1 to 77.8 ± 7.6, 73.5 ± 3.6, and 47.7 ± 2.0 nmol · min-1 · mg protein-1, respectively (Fig. 4B). However, L-NMMA did not reverse the cytokine-induced ALPase reduction (52.1 ± 1.5 nmol · min-1 · mg protein-1). The reduction in ALPase activity by cytokines exhibited a clear contrast with the increase in ALPase activity by dNO (Fig. 1). Thus the decrease in ALPase activity caused by cytokines might not be due to the production of cytokine-induced NO, which is compatible with our previous findings in mouse primary osteoblasts (12).

O-2 was not detected in MC3T3-E1 cells before stimulation by the cytokines (Fig. 5). Administration of TNF-alpha (10 ng/ml) or IL-1beta (10 ng/ml) alone did not stimulate the cells to produce O-2. Combined TNF-alpha and IL-1beta induced a significant amount of O-2 production (293.8 ± 48.5 pmol · h-1 · well-1, P < 0.0002). Any cytokine or NO/O-2 donor at the concentrations used in this study did not affect cell viability with respect to cell number, trypan blue exclusion, and the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (data not shown).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5.   Stimulatory effects of TNF-alpha and IL-1beta on O-2 production. Values are means ± SE; n = 6. * Significant difference (P < 0.01) vs. Ctl.

Effects of SOD on cytokine-induced reduction of ALPase activity and osteocalcin gene expression. Cytokine treatment reduced ALPase activity from 301.7 ± 7.3 to 68.7 ± 1.6 nmol · min-1 · mg protein-1 (P < 0.0001, Fig. 6). SOD partly reversed the reduction of cytokine-induced ALPase activity to 84.9 ± 3.6 nmol · min-1 · mg protein-1 (P < 0.02, Fig. 6). Urate restored more significantly the decrease in cytokine-induced ALPase activity (205.0 ± 13.3 nmol · min-1 · mg protein-1). RT-PCR demonstrated that coadministration of TNF-alpha and IL-1beta reduced the gene expression of osteocalcin from the control level; SOD reversed the reduced gene expression of osteocalcin (Fig. 7).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of superoxide dismutase (SOD, 100 U/ml) or urate (10-4 M) on reduction of ALPase activity induced by TNF-alpha and IL-1beta . Note that SOD and urate reversed inhibitory effects of combined TNF-alpha and IL-1beta on ALPase activity. Values are means ± SE; n = 12. * Significant difference (P < 0.02) vs. control; # significant difference (P < 0.02) vs. condition inhibited by TNF-alpha  + IL-1beta .



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 7.   Expression of osteocalcin mRNA stimulated with combination of TNF-alpha and IL-1beta . Note that SOD reversed inhibitory effect of combined TNF-alpha and IL-1beta . Lane 1, unstimulated osteoblasts; lane 2, cells treated with combination of TNF-alpha and IL-1beta ; lane 3, cells treated with TNF-alpha , IL-1beta , and SOD.

Immunodetection of ONOO- by use of anti-nitrotyrosine antibody. The action of ONOO- can be detected by the measurement of nitrotyrosine, which represents nitrosylation of cellular protein by ONOO- (3). Nitrotyrosine residues on protein are stable markers of ONOO- synthesis (3, 13). MC3T3-E1 cells showed weak nitrotyrosine expression without the addition of any chemical (Fig. 8). The combined effect of NO and O-2 produced by dNO and Pgl elevated the level of nitrotyrosine (Fig. 8). These results directly indicate that the administration of NO and O-2 produced ONOO-.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 8.   Immunocytochemistry of nitrotyrosine in osteoblasts after application of NO and O-2 donors. Values are means ± SE; n = 3. * Significant difference (P < 0.002) vs. negative control [(Nega), without antinitrotyrosine antibody]; # significant difference (P < 0.002) vs. control [(Cont), without NO/O-2 donors].

TNF-alpha (10 ng/ml) or IL-1beta (10 ng/ml) alone did not increase nitrotyrosine production (Fig. 9), whereas combined TNF-alpha and IL-1beta enhanced the production of nitrotyrosine. These data suggest that osteoblasts stimulated with TNF-alpha and IL-1beta produce more ONOO- than untreated or single cytokine-treated cells.


View larger version (137K):
[in this window]
[in a new window]
 
Fig. 9.   Immunocytochemistry of nitrotyrosine in osteoblasts after proinflammatory cytokine application. A: negative control; B: unstimulated control; C: TNF-alpha alone; D: IL-1beta alone; E: TNF-alpha plus IL-1beta . Note that the combination of TNF-alpha and IL-1beta enhanced basal production of nitrotyrosine. Bar length, 100 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

NO has significant effects on bone metabolism (8). We have previously demonstrated that NO directly facilitated osteoblastic differentiation and that it was not responsible for the cytokine-induced inhibition of osteoblastic activity in mouse primary culture (12). What is the cause of the inhibition of osteoblastic activity, even though a sufficient amount of NO is formed in the presence of TNF-alpha and IL-1beta ? In addition to NO, other more reactive and toxic substances may be formed in cytokine-stimulated osteoblasts, as presented in Fig. 10. In this investigation, we found that ONOO- synthesized in cytokine-treated cells overcame the stimulatory effect of NO per se (12) on osteoblastic differentiation.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 10.   Metabolic pathway of NO-related radicals. dNO and Pgl produce NO and O-2, respectively. NO in presence of O-2 forms a new radical, ONOO-, and ONOO- is scavenged by urate. Note that the combination of TNF-alpha and IL-1beta has a stimulatory effect on NO and O-2 production. L-NMMA inhibits NO production from L-arginine by inducible NO synthase (iNOS).

NO reacts with O-2 to form the highly reactive intermediate ONOO- (2, 16, 24). First, we examined the effects of ONOO- on osteoblastic differentiation by use of oxygen radical donors and the specific free radical scavengers. The simultaneous administration of an NO donor (dNO) and an O-2 donor (Pgl) was found to produce ONOO- and inhibit osteoblastic differentiation (Figs. 2 and 3) without affecting cell viability. The inhibitory effects of the NO and O-2 donors on osteoblastic differentiation were reversed by urate, a potent and selective ONOO- scavenger (13). These results suggest that the ONOO- formed from NO and O-2 inhibited the osteoblastic differentiation.

Proinflammatory cytokines enhance bone resorption (4, 10, 20). IL-1beta and IL-1alpha are the most powerful stimulators of bone resorption (14). Two- to threefold inhibition of osteocalcin synthesis by TNF-alpha and IL-1beta has been reported in osteoblasts (7, 25). Reduced expression of the osteocalcin gene by TNF-alpha and IL-1beta was observed in the present study (Fig. 7). TNF-alpha and IL-1beta have also reduced ALPase activity in osteoblasts (12, Fig. 4). Therefore, these cytokines have an inhibitory effect on osteoblastic differentiation. Because ONOO- produced from NO and O-2 has shown a suppressive effect on the differentiation of the cytokine-treated osteoblasts, the next step to be clarified is whether cytokine-stimulated osteoblasts actually produce both NO and O-2. TNF-alpha or IL-1beta alone or their combination yielded NO production (Fig. 4). In addition, the cytokine cotreatment also enhanced the production of O-2, although O-2 was not detected on application of only one cytokine (Fig. 5). Finally, we have verified that simultaneous generation of both NO and O-2 by TNF-alpha and IL-1beta leads to ONOO- formation (Fig. 8). ONOO- formed from NO and O-2 in these cells would nullify the stimulatory effect of NO and might even suppress osteoblastic differentiation.

There was no measurable restoration of ALPase activity by L-NMMA in the presence of cytokines. One reason that L-NMMA could not restore ALPase activity is that cytokine-induced O-2 alone suppressed the enzyme activity. This was partly ascertained by the experiment with SOD in conjunction with cytokines. SOD modestly but significantly restored both ALPase activity and osteocalcin gene expression (Fig. 6). However, the recovery of ALPase activity by SOD was not sufficient, suggesting that O-2 synthesis alone may not fully explain cytokine-induced ALPase reduction.

The rate constant for ONOO- formation from NO and O-2 is 6.7 × 109 M-1 · s-1 (21), whereas the rate constant for the scavenging of O-2 by SOD is 2.5 × 109 M-1 · s-1 (21). Therefore, the coexistence of NO and O-2 produced by the cytokine stimulation could form some amount of ONOO- even in the presence of SOD (17, 27). The produced ONOO- may participate in the reduction of ALPase activity much more than cytokine-induced O-2. Urate, an ONOO- scavenger, restored the cytokine-induced reduction of ALPase activity more markedly than SOD (Fig. 6). A similar argument could also be made for a continued production of NO at a low level even after L-NMMA preincubation. O-2 produced by the cytokine stimulation may react rapidly with NO, forming ONOO- even in the presence of L-NMMA, a competitive inhibitor of NOS activity. This would explain the reason that ALPase activity remains depressed even in the supposed absence of NO (Fig. 4). Although the reduction of ALPase activity by cytokine cannot be fully explained by the action of ONOO- alone, most of the causes may be attributed to the effects of ONOO- production. Single cytokines produced NO and did not produce O-2 (Figs. 4 and 5). Without a superoxide source, single cytokine stimulation would not produce ONOO-, yet single cytokines could inhibit ALPase activity. There may be alternate sources of O-2, such as mitochondrial respiration (23).

Damoulis and Hauschka (5) demonstrated that the NO donor S-nitroso-acetyl-penicillamine (SNAP) at a higher concentration (10-3 M) evoked cell death in MC3T3-E1 cells after long-term culture <= 73 h. Because SNAP has a half-life of 5 h at pH 7 and 37°C (15), NO produced by SNAP would affect cell viability in the first several hours of incubation. The concentration of SNAP they employed may be toxic or lethal to MC3T3-E1 cells. At the same time, dNO at a lower concentration and a longer half-life [40 h at pH 7.4 and 37°C, (6)] would be less harmful to the cells. In our study, NO produced from dNO at a submillimolar concentration could exert the biological effects during the entire incubation period. NO donors with a different half-life and concentration may cause the altered effects on osteoblasts. Damoulis and Hauschka have also shown that mouse TNF-alpha at 20 ng/ml combined with mouse IL-1beta at 5 IU/ml produced NO and reduced cell viability, although mouse TNF-alpha at 1 ng/ml with IL-1beta had no cytotoxic effect. As they mentioned, mouse TNF-alpha is more cytotoxic than human TNF-alpha , and mouse TNF-alpha at 20 ng/ml has a cytotoxic effect independent of NO. In our investigation, human TNF-alpha at 10 ng/ml with human IL-1beta at 10 ng/ml produced NO and reduced ALPase activity in osteoblasts, although it had no effect on cell viability (data not shown). Thus the action of TNF-alpha depends on the species and the concentration in the osteoblasts.

In a previous study, we were the first to demonstrate endothelial cell nitric oxide synthase (ecNOS) expression in osteoblasts (12). The constitutive production of NO may regulate osteoblast growth (8) and contribute to bone formation by mechanical stimulation (9). Fox et al. (9) have reported that administration of L-NMMA prevented the increase in bone formation by mechanical stimulation and concluded that ecNOS was responsible for the NO production. NO produced by ecNOS would be a physiological mediator of estrogen action on bone (1, 19). Estrogen deficiency might reduce the level of NO, ALPase production, and osteocalcin gene expression. Therefore, the physiological level of NO produced by ecNOS is expected to prevent the progress of osteoporosis. A large amount of O-2 would not be formed under the condition where ecNOS constitutively produced NO. In contrast, under the inflammatory conditions, not only NO from iNOS but also O-2 are produced by proinflammatory cytokines, as we demonstrated. In osteoarthritis, TNF-alpha , IL-1beta , and iNOS were highly expressed in synovial cells (22). The collaboration of these two cytokines may lead to ONOO- production, as is shown in the present report. Accordingly, ONOO- may be one of the most effective NO metabolites in cytokine-stimulated osteoblasts. In conclusion, ONOO- produced by TNF-alpha and IL-1beta , but not NO per se, would overcome the stimulatory effect of NO on osteoblastic activity and inhibit osteoblastic differentiation.


    ACKNOWLEDGEMENTS

We appreciate Chieko Hemmi for skillful assistance.


    FOOTNOTES

Part of this work was financially supported by a grand-in-aid for scientific research from the Ministry of Education, Science, and Culture and the Ministry of Health and Welfare, the Japan Foundation for Osteoporosis, and the Sankyo Foundation for Life Sciences and Sharyo Zaidan.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: H. Hikiji, Department of Oral and Maxillofacial Surgery, Faculty of Medicine, University of Tokyo, 7-3-1, Hongo, Bunkyo-ku 113-8655, Tokyo, Japan.

Received 2 June 1999; accepted in final form 5 January 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Armour, KE, and Ralston SH. Estrogen upregulates endothelial constitutive nitric oxide synthase expression in human osteoblast-like cells. Endocrinology 139: 799-802, 1998[Abstract/Free Full Text].

2.   Beckman, JS, Beckman TW, Chen J, Marshall PA, and Freeman BA. Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc Natl Acad Sci USA 87: 1620-1624, 1990[Abstract/Free Full Text].

3.   Beckman, JS, Ye YZ, Anderson PG, Chen J, Accavitti MA, Tarpey MM, and White CR. Extensive nitration of protein tyrosines in human atherosclerosis detected by immunohistochemistry. Biol Chem Hoppe Syler 375: 81-88, 1994[ISI][Medline].

4.   Bertolini, DR, Nedwin GE, Bringman TS, Smith DD, and Mundy GR. Simulation of bone resorption and inhibition of bone formation in vitro by human tumour necrosis factors. Nature 319: 516-518, 1986[Medline].

5.   Damoulis, PD, and Hauschka PV. Nitric oxide acts in conjunction with proinflammatory cytokines to promote cell death in osteoblasts. J Bone Miner Res 12: 412-422, 1997[ISI][Medline].

6.   Estévez, AG, Spear N, Pelluffo H, Kamaid A, Barbeito L, and Beckman JS. Examining apoptosis in cultured cells after exposure of nitric oxide and peroxynitrite. In: Methods in Enzymology. San Diego, CA: Academic, 1999, vol. 301, p. 393-402.

7.   Evans, DB, Thavarajah M, and Kanis JA. Involvement of prostaglandin E2 in the inhibition of osteocalcin synthesis by human osteoblast-like cells in response to cytokines and systemic hormones. Biochem Biophys Res Commun 167: 194-202, 1990[ISI][Medline].

8.   Evans, DM, and Ralston SH. Nitric oxide and bone. J Bone Miner Res 11: 300-305, 1996[ISI][Medline].

9.   Fox, SW, Chambers TJ, and Chow JWM Nitric oxide is an early mediator of the increase in bone formation by mechanical stimulation. Am J Physiol 33: E955-E960, 1996.

10.   Gowen, M, Wood DD, Ihrie EJ, McGuire MKB, and Russell RGG An interleukin 1 like factor stimulates bone resorption in vitro. Nature 306: 378-380, 1983[Medline].

11.   Green, LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, and Tannenbaum SR. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal Biochem 126: 131-138, 1982[ISI][Medline].

12.   Hikiji, H, Shin WS, Oida S, Takato T, Koizumi Y, and Toyo-oka T. Direct action of nitric oxide on osteoblastic differentiation. FEBS Lett 410: 238-242, 1997[ISI][Medline].

13.   Hooper, DC, Spitsin S, Kean RB, Champion JM, Dickson GM, Chaudhry I, and Koprowski H. Uric acid, a natural scavenger of peroxynitrite, in experimental allergic encephalomyelitis and multiple sclerosis. Proc Natl Acad Sci USA 95: 675-680, 1998[Abstract/Free Full Text].

14.   Horowitz, MC, and Lorenzo JA. Local regulators of bone: IL-1, TNF, lymphotoxin, interferon-gamma , IL-8, IL-10, IL-4, the LIF/IL-6 family, and additional cytokines. In: Principles of Bone Biology. San Diego, CA: Academic, 1996, p. 687-700.

15.   Hou, Y, Wang J, Ramirez J, and Wang PG. Glyco-S-nitrosothiols: sugar-SNAP, a new type of nitric oxide donor. In: Methods in Enzymology. San Diego,CA: Academic, 1999, vol. 301, p. 242-249.

16.   Ischiropoulos, H, Zhu L, and Beckman JS. Peroxynitrite formation from macrophage-derived nitric oxide. Arch Biochem Biophys 298: 446-451, 1992[ISI][Medline].

17.   Ischiropoulos, H, Zhu L, Chen J, Tsai M, Martin JC, Smith CD, and Beckman JS. Peroxynitrite-mediated tyrosine nitration catalyzed by superoxide dismutase. Arch Biochem Biophys 298: 431-437, 1992[ISI][Medline].

18.   Kawaguchi, H, Shin WS, Wang Y, Inukai M, Kato M, Matsuo-Okai Y, Sakamoto A, Uehara Y, Kaneda Y, and Toyo-oka T. In vivo gene transfection of human endothelial cell nitric oxide synthase in cardiomyocytes causes apoptosis-like cell death. Identification using sendai virus-coated liposomes. Circulation 95: 2441-2447, 1997[Abstract/Free Full Text].

19.   Kleinert, H, Wallerath T, Euchenhofer C, Ihrig-Biedert I, Li H, and Forstermann U. Estrogens increase transcription of the human endothelial NO synthase gene. Analysis of the transcription factors involved. Hypertension 31: 582-588, 1998[Abstract/Free Full Text].

20.   Lader, CS, and Flanagan AM. Prostaglandin E2, interleukin 1alpha and tumor necrosis factor-alpha increase human osteoclast formation and bone resorption in vitro. Endocrinology 139: 3157-3164, 1998[Abstract/Free Full Text].

21.   Lewis, RS, Tamir S, Tannenbaum SR, and Deen WM. Kinetic analysis of the fate of nitric oxide synthesized by macrophages in vitro. J Biol Chem 270: 29350-29355, 1995[Abstract/Free Full Text].

22.   Melchiorri, C, Meliconi R, Frizziero L, Silvestri T, Pulsatelli L, Mazzetti I, Borzi RM, Uguccioni M, and Facchini A. Enhanced and coordinated in vivo expression of inflammatory cytokines and nitric oxide synthase by chondrocytes from patients with osteoarthritis. Arthritis Rheum 41: 2165-2174, 1998[ISI][Medline].

23.   Poderoso, JJ, Peralta JG, Lisdero CL, Carreras MC, Radisic M, Schöpfer F, Cadenas E, and Boveris A. Nitric oxide regulates oxygen uptake and hydrogen peroxide release by the isolated beating rat heart. Am J Physiol Cell Physiol 274: C112-C119, 1998[Abstract/Free Full Text].

24.   Szabó, C, Zingarelli B, and Salzman AL. Role of poly-ADP ribosyltransferase activation in the vascular contractile and energetic failure elicited by exogenous and endogenous nitric oxide and peroxynitrite. Circ Res 78: 1051-1063, 1996[Abstract/Free Full Text].

25.   Taichman, RS, and Hauschka PV. Effects of interleukin-1beta and tumor necrosis factor-alpha on osteoblastic expression of osteocalcin and mineralized extracellular matrix in vitro. Inflammation 16: 587-601, 1992[ISI][Medline].

26.   Weinreb, M, Shinar D, and Rodan GA. Different pattern of alkaline phosphatase, osteopontin, and osteocalcin expression in developing rat bone visualized by in situ hybridization. J Bone Miner Res 5: 831-842, 1990[ISI][Medline].

27.   White, CR, Brock TA, Chang L, Crapo J, Briscoe P, Ku D, Bradley WA, Gianturco SH, Gore J, Freeman BA, and Tarpey MM. Superoxide and peroxynitrite in atherosclerosis. Proc Natl Acad Sci USA 91: 1044-1048, 1994[Abstract/Free Full Text].

28.   Xie, Y, and Wolin MS. Role of nitric oxide and its interaction with superoxides in the suppression of cardiac muscle mitochondrial respiration: involvement in response to hypoxia/reoxygenation. Circulation 94: 2580-2586, 1996[Abstract/Free Full Text].


Am J Physiol Endocrinol Metab 278(6):E1031-E1037
0193-1849/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. Abe, H. Hikiji, W. S. Shin, N. Koshikiya, S.-i. Shima, J. Nakata, T. Susami, T. Takato, and T. Toyo-oka
Targeting of iNOS with antisense DNA plasmid reduces cytokine-induced inhibition of osteoblastic activity
Am J Physiol Endocrinol Metab, September 1, 2003; 285(3): E614 - E621.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hikiji, H.
Right arrow Articles by Toyo-Oka, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hikiji, H.
Right arrow Articles by Toyo-Oka, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online