AJP - Endo  AJP: Regulatory, Integrative and Comparative Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 278: E892-E901, 2000;
0193-1849/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Levy, J. R.
Right arrow Articles by Stevens, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Levy, J. R.
Right arrow Articles by Stevens, W.
Vol. 278, Issue 5, E892-E901, May 2000

Dual regulation of leptin secretion: intracellular energy and calcium dependence of regulated pathway

James R. Levy, Judit Gyarmati, John M. Lesko, Robert A. Adler, and Wayne Stevens

Section of Endocrinology and Metabolism, McGuire Veterans Administration Medical Center and Medical College of Virginia/Virginia Commonwealth University, Richmond, Virginia 23249


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Rodent leptin is secreted by adipocytes and acutely regulates appetite and chronically regulates body weight. Mechanisms for leptin secretion in cultured adipocytes were investigated. Acutely, energy-producing substrates stimulated leptin secretion about twofold. Biologically inert carbohydrates failed to stimulate leptin secretion, and depletion of intracellular energy inhibited leptin release. There appears to be a correlation between intracellular ATP concentration and the rate of leptin secretion. Insulin increased leptin secretion by an additional 25%. Acute leptin secretion is calcium dependent. When incubated in the absence of calcium or in the presence of intracellular calcium chelators, glucose plus insulin failed to stimulate leptin secretion. In contrast, basal leptin secretion is secreted spontaneously and is calcium independent. Adipocytes from fatter animals secrete more leptin, even in the absence of calcium, compared with cells from thinner animals. Acute stimulus-secretion coupling mechanisms were then investigated. The potassium channel activator diazoxide and the nonspecific calcium channel blockers nickel and cadmium inhibited acute leptin secretion. These studies demonstrate that intracellular energy production is important for acute leptin secretion and that potassium and calcium flux may play roles in coupling intracellular energy production to leptin secretion.

adipocytes; potassium channels; calcium channels


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

THE STUDY OF the physiological regulation of total body energy storage has been greatly stimulated with the discovery of leptin, the 16,000 relative molecular weight hormone product of the ob gene (40). Produced by adipocytes (40) and placenta (21), leptin is intimately associated with the regulation of body weight. In rodents, chronic and acute physiological roles have been ascribed to leptin. Chronically, leptin fulfills the role of an adipostat, a sensor of body adiposity. The adipostat role is based on the strong association between leptin gene expression, circulating leptin levels, and percent body fat (10, 18, 20, 37). Leptin receptors (5, 6) are found within the hypothalamus, the center that controls appetite and metabolic rate. Furthermore, when given exogenously, leptin has been shown to inhibit feeding, diminish body fat, and increase metabolic rate (4, 13, 29, 30, 39).

Leptin may also act acutely on several physiological and metabolic pathways that regulate appetite (satiety) and energy expenditure. To be acutely responsive in vivo, hormone secretion must react to physiologically relevant stimuli. In fasted rodents, leptin levels fall at a rate that cannot be accounted for by the loss of body fat alone (33). Within 2-3 h of ingestion of chow (36), the intravenous infusion of total parenteral nutrition, or the intravenous infusion of glucose (17), adipocyte leptin mRNA and circulating hormone levels rise. The regulation of acute leptin secretion is incompletely understood. Much evidence points to insulin as a hormone that regulates the starvation and meal-induced modulation of leptin levels. For instance, circulating leptin levels decline in streptozotocin-treated rodents, but leptin levels increase when the animals are given insulin (33). Incubation of cultured rat adipocytes with insulin results in increased leptin gene expression (41) and secretion (1). In addition to insulin, a few studies have suggested that glucose regulates leptin gene expression and secretion. Mizuno et al. (24, 25) found that leptin gene expression correlated better with plasma glucose than with plasma insulin in mice injected with glucose intraperitoneally. Mueller et al. (26) have demonstrated that the metabolism of glucose is necessary for leptin release from cultured adipocytes. In the latter study, the glucose-mediated release of leptin from adipocytes was most apparent after 24-72 h in culture.

In the present investigation, we sought to better define the regulation of leptin secretion from rodent adipocytes. We will present evidence that supports the hypothesis that leptin secretion is dually regulated. Spontaneous leptin secretion is dependent on the amount of the hormone synthesized; the quantity of leptin release is generally not dependent on intracellular calcium flux. Acute leptin secretion depends on the availability and metabolism of energy substrate; the quantity of hormone released varies with intracellular calcium flux.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Release of leptin from cultured rat adipocytes. All animals were humanely treated, and the experimental protocols were reviewed and accepted by the Institutional Animal Care and Use Committee at Virginia Commonwealth University. Male Sprague-Dawley rats (150-500 g; Harlan Sprague-Dawley, Indianapolis, IN) were anesthetized with Metofane before decapitation. For our experiments, we chose to study isolated adipocytes from the epididymal fat pad. This fat is easily accessible and is metabolically active; leptin gene expression from this site has been shown to be modulated by fasting, refeeding, and by insulin (25, 33). Leptin gene expression from epididymal fat is similar to expression in other fat stores (14, 20). Finally, leptin release from isolated adipocytes from epididymal fat has been studied previously (1, 26). Epididymal fat pads were dissected away from the epididymis and other connective tissue. Epididymal fat pads are composed of a heterogeneous population of adipocytes. We have found that leptin release from adipocytes located near the tip is not responsive to the leptin secretagogues insulin and glucose. Therefore, we cut the epididymal fat pad in approximately two equal halves and discarded the distal half. The fat pad located at the base was minced and incubated with 2.5 mg/ml of collagenase, as described by Rodbell (32) and modified by Marshall (19). After being filtered through a mesh and washed, the adipocytes were pooled, divided into equal aliquots, and incubated in a 37°C incubator (5% CO2) in a defined medium, as detailed in the Leptin response sections in METHODS. Unless otherwise indicated, the volume of medium added was equal to the volume of pooled cells. Animals of similar size were used in similar experiments because cell size varies directly with fat stores of the animal (15). Because of this, cell concentration varied according to the size of the animal. In experiments with ~200-g animals, the concentration of cells was ~5 × 106 cells/ml (as determined by hemocytometer). In experiments with 400-g animals, the concentration of cells was ~3 × 106 cells/ml. After various times of incubation, 200 µl of medium were withdrawn, and leptin levels were measured with the Rat Leptin RIA kit as described by the supplier (Linco Research, St. Charles, MO). The limit of sensitivity and linearity for the rat leptin assay is 0.5 and 50 ng/ml, respectively. The interassay variation for the leptin assay at 1.6 ng/ml (quality control 1) was 2.5%.

Leptin response to glucose and other intracellular energy-modulating substrates. Pooled isolated adipocytes from the base of epididymal fat pads were divided equally and incubated in base DMEM (D5030; Sigma) at a concentration of 500 µl of cells in 500 µl of medium. The base DMEM is identical to complete DMEM (D5523; Sigma) but contains no glucose, pyruvate, or L-glutamine. Because glucose and pyruvate were independent variables in this experiment, they were eliminated from the medium as energy sources. All media were supplemented with 0.5% FBS, 10 mM HEPES, 2 mM L-glutamine, and 5 mg/ml BSA (fraction V; Sigma). The cells were then incubated without or with 100 ng/ml of insulin in the absence or presence of various concentrations of D-glucose (5, 15, or 25 mM) or 25 mM concentrations of L-glucose, galactose, fructose, alanine, pyruvate, and 2-deoxyglucose (2-DG). The concentration of insulin was chosen to maximally stimulate glucose uptake. However, other sources of energy were present in the medium, including the 2 mM L-glutamine and other amino acids present in DMEM. After 4 h, 100 µl of medium were withdrawn to assay for leptin concentration.

Leptin response to extracellular and intracellular calcium. Pooled isolated adipocytes from the base of the epididymal fat pad were divided equally and incubated in a calcium-free MEM (M4767; Sigma) at a final concentration of 1.4 ml of cells in 1.4 ml of medium. All media were supplemented with 1 mM pyruvate as an additional energy source. After 1 h, leptin concentration was measured in the calcium-free medium. Next, equal volumes (200 µl) of either MEM alone, MEM and glucose plus insulin, MEM and calcium, or MEM, glucose, insulin, and calcium were added. To bind trace concentrations of calcium, EGTA (100 µM) was added to each solution. Final concentrations were 25 mM glucose, 100 ng/ml insulin, and 1 mM calcium. Leptin concentrations were measured at various times after the addition of substrates, hormones, and ions.

To determine the effect of intracellular calcium flux on leptin secretion, pooled isolated adipocytes were incubated without or with the intracellular calcium chelator 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (BAPTA)-AM (20 µM) for 1 h in complete DMEM. The cells were then washed, divided equally, and incubated with complete DMEM supplemented without and with glucose (25 mM) plus insulin (100 ng/ml). The final concentration was 500 µl of cells in 500 µl of medium. After 4 h, the leptin concentration in the medium was measured.

Leptin response to potassium and calcium channel modulators. Pooled isolated adipocytes from the base of the epididymal fat pad were divided equally and incubated in base DMEM. The final concentration was 0.5 ml of cells in 0.5 ml of medium. The medium was supplemented without or with glucose (25 mM) plus insulin (100 ng/ml) and without or with various concentrations of the ion channel modulators glibenclamide, diazoxide, nimodipine, verapamil, cadmium chloride (CdCl2), and nickel chloride (NiCl2). After 4 h, leptin concentration was measured in the medium.

Measurement of intracellular ATP concentration. Intracellular ATP was measured with an ATP bioluminescence assay kit according to the instructions of the supplier (cat. no. 1 699 695; Boehringer Mannheim). In brief, ~106 adipocytes/ml were lysed in lysis reagent, and, after the centrifugation, aliquots of supernatant were diluted in buffer supplied in the kit. The luciferase reagent was added 1 s before a 5-s measurement in the luminometer, as described by the supplier. The test principle of the assay is that luciferase from Photinus pyralis (American firefly) catalyses D-luciferin in the presence of ATP and oxygen to oxyluciferin, Pi, AMP, carbon dioxide, and light. Light photons were measured by a luminometer and were compared with a standard curve to calculate ATP concentration.

Northern blot analysis. Isolated rat adipocytes were incubated in DMEM, 10 mM HEPES, 0.5% BSA, and 5 mg/ml BSA in the absence and addition of D-glucose, as indicated in text and Figs. 1-8. Total RNA (15 µg) was applied to a 1% agarose-2 M formaldehyde denaturing gel according to standard procedure (7). After electrophoresis, the RNA was transferred to a nylon membrane (Hybond-N; Amersham) by capillary action and fixed by ultraviolet light cross-linking. Either leptin or cyclophilin (control) cDNA probes were radiolabeled with [32P]dCTP by random primer extension according to the instructions of the supplier (Boehringer Mannheim). Hybridization was performed in a solution as described by the supplier. After 24 h of incubation at 65°C, the filter was washed two times for 5 min at 65°C in 2× SSC (20× = 2 M NaCl and 0.3 M sodium citrate, pH 7.0) and 0.1% SDS and subsequently one time in 1× SSC and 0.1% SDS for 15 min at 65°C. The filter was exposed to a phosphorimager (Phosphorimager SF; Molecular Dynamics) cassette overnight, and photons from the appropriate bands were measured. Cyclophilin gene expression was a good control; cyclophilin mRNA levels did not vary between any of the experimental groups and controls.

The leptin cDNA probe was synthesized from rat adipocyte RNA by RT-PCR. First-strand cDNA synthesis of total RNA was catalyzed by Superscript II, as described by the supplier (Life Technologies). The cDNA was PCR amplified with the following sense and antisense primers for leptin (28): sense, CCTATCCACAAAGTCCAGGA; antisense, ATGTCCTGCA GAGAGCCCTG. The PCR was "hot started," and the PCR parameters were as follows: denaturation at 95°C for 30 s, annealing at 55°C for 40 s, and extension at 72°C for 45 s for a total of 35 cycles.

Statistical analysis. We have found that the magnitude of leptin secretion from control adipocytes (incubated in the absence of leptin secretagogues) varied considerably from one set of experiments to the next. Methodological conditions that caused variation in the leptin secretory rate included the type of anesthetic agent, the length of exposure to the anesthetic agent Metofane, the concentration of collagenase, the time of exposure to collagenase, the type and lot of collagenase, the anatomic localization of fat cells in the epididymal fat pad (tip vs. base), substrates within the incubation medium, the "gentleness" of the washes, the size of the animal, and the size of the epididymal fat pad. Other unknown conditions must be playing roles in the magnitude of leptin release from adipocytes because, despite our best efforts to control for the above conditions, the release of leptin from control cells still varied up to fivefold from experiment to experiment. Because of the variation in the absolute amount of leptin released in control cells, some of the data were expressed as a degree of increase or decrease in leptin concentration in medium bathing cells treated with leptin secretagogues or inhibitors (experimental group) vs. the leptin concentration in medium bathing cells without leptin secretagogues or inhibitors (control group). Equal aliquots of adipocytes from pooled cells provided similar numbers of cells from the experimental and control groups in one experiment. To determine if the fractional change was statistically significant, we performed a one-sample t-test, two-tailed, different from 1.0 (version 1.15; GraphPad Instat software). If two experimental conditions were compared, we performed an unpaired t-test, two-tailed (version 2.01; GraphPad Prism). We provide the absolute leptin concentration ± SE and the range of the leptin concentration in the medium from the control group in the legends for Figs. 1-8.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Three to four hours after the intravenous infusion of total parenteral nutrition, or glucose, or after the ad libitum feeding of a regular chow diet, rat serum leptin levels increased approximately threefold more than fasting serum leptin levels (17, 36). To determine if glucose and insulin stimulate leptin release in vitro in a time frame consistent with whole animal studies, isolated adipocytes were incubated with various doses of glucose without or with insulin. After 4 h, the concentration of leptin in the medium was measured. As shown in Fig. 1, glucose significantly stimulated leptin release in the medium in a dose-responsive manner. In this experiment, 25 mM glucose increased leptin secretion by ~3.5-fold. We did not observe additional significant increases in leptin release by insulin in the control or glucose-treated groups in this small experiment (n = 3). However, when we combined several experiments with adipocytes incubated with 25 mM glucose without or with insulin (100 ng/ml) for 4 h, insulin increased leptin secretion by an additional 1.26 ± 0.08-fold (n = 12, P < 0.01). To determine if energy-producing substrates other than glucose stimulate leptin release, isolated adipocytes were incubated with equal concentrations (25 mM) of D-glucose, fructose, alanine, and pyruvate in the absence or presence of insulin (100 ng/ml). As controls, adipocytes were also incubated with substrates that cannot be metabolized by cells. In the experiment shown in Fig. 2, D-glucose increased leptin secretion by 2.13-fold (P < 0.05). Leptin secretion in cells incubated with the nonmetabolized carbohydrates L-glucose and galactose was not statistically different from hormone secretion from control cells. Fructose, alanine, and pyruvate increased leptin secretion 1.8 ± 0.15 (P < 0. 05)-, 1.74 ± 0.13 (P < 0.05)-, and 1.70 ± 0.18 (P < 0.05)-fold compared with control cells. The effects of insulin to further stimulate leptin release were small and statistically significant in cells treated with alanine and pyruvate.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1.   Leptin secretion in response to various doses of glucose. Isolated rat adipocytes were incubated in base DMEM with the indicated concentrations of glucose, as described in METHODS. After 4 h, the concentration of leptin was measured in the medium. Each bar represents the mean ± SE from 3 separate experiments. * P < 0.01 compared with cells incubated without glucose. # P < 0.05 compared with cells incubated in 5 mM glucose.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of various substrates and an energy inhibitor on leptin secretion. Isolated rat adipocytes were incubated in base DMEM without (Ctrl) or with 25 mM concentrations of D-glucose (D-Glu), L-glucose (L-glu), galactose (Gal), fructose (Fruct), alanine (Ala), pyruvate (Pyr), or 2-deoxyglucose (2-DG) in the absence (open bars) and presence (filled bars) of insulin, as described in METHODS. After 4 h, leptin concentration was measured in the medium. Leptin values in each experimental group were expressed as a fraction of control [experimental group (Exp)/Ctrl], and each data point represents the mean ± SE. The effect of each substrate compared with control was measured on 3 separate occasions. Every substrate was not necessarily tested on the same day. Absolute leptin concentrations in medium from the control group were 2.24 ± 0.68 ng/ml (range 1.18-5.59 ng/ml), n = 6. * P < 0.05 (Student's t-test compared with degree of change in leptin concentration from cells incubated with either L-glucose or galactose). ** P < 0.05 (Student's t-test compared with degree of change in leptin concentration from cells incubated with same substrate but no insulin).

Adipocytes incubated with energy-producing substrates stimulate leptin secretion. Energy-neutral substrates have no effect on leptin secretion. We next examined the effects of energy depletion on leptin secretion. Incubation of cells with 2-DG has been demonstrated to deplete intracellular energy (23, 35). To verify that 2-DG depletes isolated adipocytes of intracellular energy, equal numbers of cells were incubated in base DMEM supplemented without (control) or with glucose plus insulin or with 2-DG. A time course of intracellular ATP concentrations, as measured by bioluminescence, is shown in Fig. 3A. In control cells, there is a steady decline in the intracellular concentration of ATP, because ATP utilization exceeds ATP generation in cells that are incubated in a medium that contains no glucose. The final ATP concentration is approximately one-third the initial ATP concentration. Glucose and insulin stimulate a steady rise in ATP for 2 h and then plateau. The final ATP concentration is ~50% more than the initial ATP concentration. Even in the absence of glucose, 2-DG rapidly accelerates the decline in ATP concentrations compared with control cells. The decline in intracellular energy is associated with a reduction in the amount of leptin released from cells. As shown in Figs. 2 and 3B, cells incubated with 2-DG release ~50% (P < 0.01) less leptin in 4 h compared with control cells. Glucose plus insulin stimulate leptin release from adipocytes. As shown in Fig. 3C, there appears to be a correlation between the intracellular ATP concentration and the rate of leptin release from cells incubated without and with glucose plus insulin and with 2-DG. Adipocytes incubated with 2-DG remain viable by trypan blue exclusion techniques. Furthermore, we washed 2-DG from cells after the 4-h incubation and reincubated the cells with 25 mM glucose and 100 ng/ml of insulin. After 24 h, leptin secretion was stimulated 10-fold compared with cells incubated in base DMEM, demonstrating that adipocytes exposed to 2-DG remained functionally viable (data not shown).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3.   Time course of intracellular ATP and extracellular leptin concentrations. Isolated adipocytes were incubated without or with glucose (25 mM; G) plus insulin (100 ng/ml; I) or 2-DG (25 mM), and intracellular ATP concentrations (A) and extracellular leptin concentrations (B) were measured at 1, 2, and 4 h, as described in METHODS. C: rate of leptin released (ng of leptin released · ml-1 · h-1) from adipocytes incubated in the indicated conditions was calculated. Each data point represents the mean ± SE from 3 independent experiments. * P < 0.05 (Student's t-test compared with control). ** P < 0.01 (Student's t-test compared with control).

We next studied the effect of insulin and glucose on leptin gene expression to better understand the mechanism of insulin and glucose-mediated leptin release. As shown in Fig. 4, inset, glucose and/or insulin had no effect on cyclophilin gene expression; the expression of the cyclophilin gene served as a good control for RNA loading and transfers. On the other hand, glucose or glucose plus insulin increased leptin gene expression in a dose-dependent manner. Quantitative phosphorimaging of three separate experiments revealed that leptin gene expression increased by 18 and 25% in adipocytes incubated with 15 and 25 mM glucose, respectively, compared with cells incubated with 5.6 mM glucose. In the presence of insulin, leptin mRNA levels increased ~30-40% at all glucose concentrations. Therefore, leptin mRNA levels were ~60% greater in cells incubated with 25 mM glucose and 100 ng/ml of insulin compared with cells incubated in DMEM without supplementation with glucose and insulin.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   Leptin and cyclophilin RNA levels in adipocytes incubated with glucose and insulin. Adipocytes were incubated in full DMEM with the addition of various concentrations of glucose (final concentration = 5.6-25 mM glucose) and in the absence and presence of 100 ng/ml of insulin. After 4 h, RNA was extracted, and Northern analysis was performed with the cDNA probes for leptin and cyclophilin. Inset: representative Northern analysis. Bands were quantified by phosphorimaging. Each data point represents the mean ± SE (n = 3) of normalized leptin RNA (intensity of leptin band/intensity of cyclophilin band) from cells of each experimental group divided by normalized leptin RNA from cells incubated with 5.6 mM glucose alone.

The secretion of several hormones depends on a rise in intracellular calcium. Incubation of secretory cells in a calcium-free medium will rapidly deplete intracellular calcium and will markedly inhibit calcium-responsive hormone release. To determine the role of intracellular calcium depletion on leptin secretion, isolated adipocytes were incubated in a calcium-free medium with the addition of the extracellular calcium chelator EGTA (100 µM). After 1 h, the medium was supplemented without or with glucose plus insulin, with calcium, or with glucose, insulin, and calcium. A time course of leptin release is shown in Fig. 5. In the absence of calcium, leptin is slowly released, increasing ~50% between hours 1 and 2 and an additional 25% between hours 2 and 5. The addition of calcium increases leptin secretion by twofold in 5 h. The glucose plus insulin-mediated leptin release is dependent on calcium. In the absence of calcium, glucose and insulin have minimal effect in stimulating leptin release. However, in the presence of calcium, glucose plus insulin stimulate leptin secretion by approximately fivefold. No stimulation of leptin secretion could be detected in the 1st h in the presence of these secretagogues.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of extracellular calcium on glucose plus insulin-mediated leptin secretion. Equal aliquots of isolated adipocytes were incubated in MEM and supplemented with 1 mM pyruvate, as described in METHODS. After 1 h, equal volumes of either MEM alone (), MEM and glucose (Glu) plus insulin (Ins; black-triangle), MEM and calcium (Ca2+; down-triangle), or MEM, glucose, insulin, and calcium (star ) were added. To bind trace concentrations of calcium, EGTA (100 µM) was added to each solution after the 1st h. Final concentrations were 25 mM glucose, 100 ng/ml insulin, and 1 mM calcium. Leptin concentrations were measured after 0, 15, 30, 60, and 240 min. Each data point represents the mean ± SE from 3 separate experiments. * P < 0.001 (Student's t-test compared with control at 5 h).

To verify that intracellular calcium flux was necessary for mediating leptin secretion by glucose and insulin, we measured glucose plus insulin-mediated leptin release in the presence of the intracellular calcium chelator BAPTA-AM. Preincubation with BAPTA-AM inhibited leptin secretion by ~50%, as shown in Fig. 6. BAPTA-AM had no effect on leptin secretion from cells not incubated with glucose and insulin (data not shown). Chelating intracellular calcium does not prevent leptin release but prevents substrate-mediated leptin secretion.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 6.   Time course of glucose plus insulin-mediated leptin secretion in adipocytes treated without or with a chelator of intracellular calcium. Adipocytes were preincubated without () or with () 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (BAPTA)-AM, washed, and reincubated with glucose plus insulin, as described in METHODS. Leptin concentration was measured at times indicated. Each point represents the mean ± SE of 3 separate experiments. SE were too small to be drawn accurately in 3 of the data points. * P < 0.0001 (Student's t-test compared with BAPTA-treated cells at 4 h).

To determine if glucose plus insulin mediate leptin secretion through stimulation of calcium channels, adipocytes were incubated for 4 h with the leptin secretagogues in the absence and presence of various concentrations of calcium channel blockers. Nimodipine and verapamil had no effect on leptin secretion. The nonspecific calcium channel blockers NiCl2 and CdCl2 inhibited glucose plus insulin-mediated leptin release, as shown in Fig. 7. The sensitivity of the inhibitory response was different with the two cations. The concentration of cation at which one-half of the maximal leptin secretory response was inhibited was ~1 and 10 mM for CdCl2 and NiCl2, respectively.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of nickel (NiCl2) and cadmium (CdCl2) on leptin secretion. Adipocytes were incubated in base DMEM and supplemented with 1 mM pyruvate, glucose (25 mM), and insulin (100 ng/ml) and the indicated concentrations of either NiCl2 or CdCl2. After 4 h, leptin was measured. Each data point is calculated by dividing the concentration of leptin in NiCl2- or CdCl2-treated cells (Exp) by the leptin concentration in medium that does not contain NiCl2 or CdCl2 (Ctrl). Each bar represents the mean ± SE from 3 separate experiments. Absolute values of leptin concentration from cells incubated without NiCl2 or CdCl2 were 2.8, 2.7, and 1.4 ng/ml. * P < 0.01 (Student's t-test compared with 0.01 mM of the respective cation).

The intracellular mechanism for substrate-mediated coupling to leptin secretion was investigated. Previous studies have suggested that the hexosamine biosynthetic pathway is a cellular "sensor" of energy availability and mediates the effects of glucose on the expression of the ob gene (38). We therefore incubated isolated adipocytes with various concentrations of glucosamine (0.1, 1, 10, and 25 mM) in complete DMEM and measured the release of leptin after 4 h. Glucosamine did not stimulate leptin secretion in our primary cell system (data not shown). Energy generation and closure of ATP-sensitive potassium channels have also been shown to couple glucose delivery to hormone secretion. To determine if potassium channels play a role in leptin secretion, adipocytes were incubated with the potassium channel stimulator diazoxide. Diazoxide inhibits both basal and the glucose plus insulin-mediated leptin secretion from adipocytes in a dose-dependent manner, as shown in Fig. 8.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of potassium channel stimulation on leptin secretion. Adipocytes were incubated in DMEM supplemented with glucose (25 mM) and insulin (100 ng/ml) in the absence and presence of various concentrations of diazoxide, an agent that opens potassium channels. After 4 h, leptin concentration was measured in the medium. Each bar represents the mean ± SE (n = 4) of the leptin concentration in the diazoxide-treated cells expressed as a fraction of the control cells (no diazoxide). Absolute leptin concentration in the control cells was 7.3 ± 5.1 ng/ml. * P < 0.05 (1-sample t-test, different from 1.0, which is the control value).

The time course of leptin release in the absence and presence of calcium suggests that, functionally, leptin secretion is dually regulated; basal or spontaneous leptin secretion is largely calcium independent, and substrate-mediated leptin secretion is calcium dependent. These two functionally distinct in vitro pathways of leptin secretion may partially explain why a dual regulation of leptin secretion is observed in whole animal studies. We hypothesize that the basal calcium-independent pathway regulates leptin release that is responsive to adiposity and that the acute, calcium-dependent, pathway regulates leptin release that is responsive to changes in energy flux. Our hypothesis would predict that spontaneous leptin secretion should vary directly with adiposity, even when incubated in the absence of calcium. We therefore measured leptin secretion in calcium-free medium, bathing adipocytes extracted from epididymal fat pads from animals with various weights (from ~220 to 463 g). As shown in Table 1, animals that weigh more have more epididymal fat stores. The distribution of size of the isolated adipocytes was shifted to the right, with an average size of 60 and 80 µm in 220- and 463-g animals, respectively (data not shown). Isolated adipocytes obtained from heavier animals secrete significantly more leptin per cell, even in the absence of extracellular calcium. Compared with cells obtained from 220-g animals, cells obtained from 463-g animals secrete approximately fivefold more leptin.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Effect of adiposity on calcium-independent leptin secretion


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We have shown that substrates that produce intracellular energy within adipocytes enhanced leptin secretion. D-Glucose, fructose, pyruvate, and alanine all stimulated leptin secretion, whereas substrates that are not metabolized, such as L-glucose and galactose, had no effect on leptin secretion. Furthermore, substrates that deplete intracellular energy, such as 2-DG (23, 35), inhibited leptin release. A previous study also demonstrated that glucose delivery and metabolism stimulated leptin release from cultured adipocytes (26). Our studies differ in a couple of ways. First, we demonstrated leptin release from isolated adipocytes in suspension rather than adipocytes attached to a solid support. Second, in the previous report, most of the stimulatory effect of the substrate was demonstrated after 24 h in culture. We demonstrated that incubation of cells with energy-producing substrates stimulated leptin release within hours, a time frame consistent with the rise in serum leptin observed after rodents ingest a meal or are infused with total parenteral nutrition. Consistent with a number of different laboratories, we have also shown that insulin stimulated leptin secretion. However, the magnitude of leptin secretion in response to maximal concentrations of insulin was much less than maximal concentrations of energy-producing substrates. We propose that insulin regulates leptin release from adipocytes in at least two ways. We and others have demonstrated that insulin enhances leptin gene expression and therefore probably enhances efflux of leptin through a constitutive or spontaneous pathway. Second, insulin indirectly stimulates leptin release by mediating nutrient transport, thus providing cells with the substrate necessary for the generation of intracellular energy.

Glucose, fructose, pyruvate, and alanine are all metabolized via the glycolytic pathway, although each enters the pathway at a different point. The rate of leptin secretion was comparable in the presence of any of these substrates, but leptin release was very slow when all substrates were omitted from the medium. Thus the presence of substrate and ongoing glycolysis appears to enhance leptin secretion, and the steps distal to pyruvate seem to be of particular importance. Furthermore, the fact that leptin secretion occurs at an enhanced rate in the presence of fructose, pyruvate, lactate, and alanine, which do not enter cells via the glucose transport carrier to any appreciable extent, indicates that ongoing flux through the glucose transport system is not a prerequisite for leptin secretion to occur.

Leptin secretion appears to be dually regulated. Adipocytes deprived of nutrient and insulin released leptin at a slow and relatively constant rate. This basal, spontaneous leptin secretion was largely independent of intracellular calcium. However, spontaneous leptin secretion was regulated; the secretory rate was dependent on the synthesis of leptin and varied according to the size and triglyceride stores of the cell. When incubated without calcium, adipocytes obtained from older and fatter animals secreted more leptin than adipocytes obtained from younger and thinner animals. We hypothesize that the spontaneous leptin secretion is responsible for the chronic, adiposity-mediated regulation of leptin secretion observed in whole animal studies. We also provided evidence that leptin secretion is acutely regulated by a substrate and calcium-dependent mechanism. Glucose and insulin markedly increased leptin secretory rates compared with the spontaneous secretory rate. In contrast to the calcium-independent regulation of spontaneous leptin secretion, the substrate-mediated stimulation was completely inhibited if cells were incubated in the absence of calcium or if calcium was removed with either extracellular or intracellular calcium chelators. Although we propose two functionally distinct pathways, we provide no evidence that these pathways are anatomically distinct. It is still very possible that glucose, insulin, and calcium are accelerating a spontaneous or basal leptin secretory rate.

The stimulus-secretion coupling mechanism for the regulatory pathway is incompletely understood. We and others have demonstrated that insulin, in the presence of glucose, stimulates leptin gene expression (33, 41). In the present study, we have shown that glucose, even in the absence of insulin, stimulates leptin gene expression. However, regulation of protein synthesis may not be the only mechanism of substrate-induced leptin secretion. Evidence that cytosolic pools of leptin may be acutely released by leptin secretagogues is accumulating. For instance, Barr et al. (1) have demonstrated that insulin-mediated leptin secretion from adipocytes occurs well before a cell is capable of de novo synthesis of a hormone and release from the plasma membrane. In addition, Bradley and Cheatham (3) have demonstrated that the insulin-stimulated leptin release from adipocytes occurs even in the presence of transcription and protein synthesis inhibition (3). Both investigators have argued that their data are consistent with the view that insulin acutely mobilizes preformed pools of leptin in rat adipocytes. We were unable to verify the very quick time frame of glucose plus insulin-mediated leptin release described by Barr et al. (1). However, we believe that our data best fit the model that release of stored cytosolic pools of leptin is stimulated by energy and calcium-dependent processes. That the time frame of release of leptin is >1 h does not exclude this model. Gaur et al. (11) have found that deprivation of growth hormone regulates intracellular calcium in rat epididymal adipocytes by regulating the distribution of L-type calcium channels; changes in intracellular calcium are observed after 3 h. This group (12) also found that insulin produces a growth hormone-like increase in intracellular free calcium concentration in adipocytes treated with a phosphatase inhibitor. Again, the time course for the insulin effect was in the 1-h time range, not in the minute range that we expect with calcium channel activators in excitable tissue or neurosecretory cells.

We also studied mechanisms for stimulus-leptin secretion coupling in isolated adipocytes. Wang et al. (38) have proposed that the hexosamine biosynthetic pathway is a cellular sensor of energy availability and mediates the effects of glucose on the expression of the leptin gene. We failed to show an effect of glucosamine on leptin secretion in our in vitro system. Rather, we provided evidence that calcium flux and perhaps potassium channels play roles in coupling substrate metabolism with leptin release. When potassium channels were stimulated with diazoxide, glucose plus insulin-mediated leptin secretion was inhibited. This is compatible with the hypothesis that glucose metabolism within adipocytes results in increased energy and reducing equivalents that mediate the closure of ATP-sensitive potassium channels and a rise in intracellular calcium and leptin secretion. Electrophysiological studies of ionic flux in adipocytes and the protein structures and channels responsible for transport of ions are limited.

Substrate-mediated hormone release is not unique to the adipocyte. Obviously, the best-studied example of a cell that secretes a hormone in response to the metabolism of an energy-producing substrate is the pancreatic beta -cell (for review, see Refs. 22 and 27). There appear to be several similarities between the secretion of leptin and insulin, two hormones intimately associated with energy disposal and body weight homeostasis. Substrate-mediated hormone secretion by adipocytes and beta -cells requires substrate metabolism and a rise in intracellular calcium. In addition, glucose stimulates gene expression of both hormones. Despite the similarities, there are several differences in the mechanism of insulin release from the beta -cell and leptin release from adipocytes. First, glucose stimulates the exocytosis of insulin-containing cytosolic vesicles. Leptin staining within Golgi or in secretory vesicles has not been detected (1). Pilot studies from the laboratory of Bradley and Cheatham (3) have demonstrated that leptin may be stored in a subcellular internal membrane fraction. In addition, calcium-mediated insulin release is partially mediated by opening dihydropyridine-sensitive calcium channels. Calcium channel blockers, such as nimodipine and verapamil, had no effect in blocking substrate-mediated leptin secretion. Last, glucose stimulates insulin release from cultured islets within minutes. However, the time course of substrate-mediated leptin release is much longer.

We also demonstrated that leptin was released from adipocytes in a calcium-independent and -dependent manner. The mechanism of how calcium regulates leptin secretion remains unclear. Past studies in adipocytes demonstrate conflicting results about whether glucose and insulin stimulate a rise in intracellular calcium. One group of investigators has demonstrated an increase in intracellular calcium when isolated adipocytes were incubated with either insulin or glucose or sulfonylureas (8, 9, 34). However, in a study performed at the National Institutes of Health (NIH; see Ref. 16), there was no detection of an insulin-mediated effect on adipocyte intracellular calcium. It must be noted that, in the NIH study, adipocytes were incubated in only 2 mM glucose. If insulin mediates calcium channel opening by increasing the delivery and metabolism of substrates, perhaps the 2 mM glucose concentration was insufficient to affect changes in intracellular energy generation and calcium channel activity. Calcium channels have never been cloned or isolated from adipocytes, but there is evidence that they functionally exist. Adipocyte glucose transport activity appears to be modulated by dihydropyridine-sensitive, voltage-dependent calcium channels (2, 31). Whether calcium channels play a role in leptin secretion awaits further investigation.


    ACKNOWLEDGEMENTS

We thank Andrew Meng for technical assistance.


    FOOTNOTES

This work is supported by the Veterans Administration Merit Review (J. R. Levy).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: J. R. Levy, McGuire Veterans Administration Medical Center 111-P, 1201 Broad Rock Blvd., Richmond VA 23249 (E-mail: James.Levy{at}med.va.gov).

Received 24 May 1999; accepted in final form 19 November 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Barr, VA, Malide D, Zarnowski MJ, Taylor SI, and Cushman SW. Insulin stimulates both leptin secretion and production by rat white adipose tissue. Endocrinology 138: 4463-4472, 1997[Abstract/Free Full Text].

2.   Begum, N, Leitner W, Reusch JE, Sussman KE, and Draznin B. GLUT-4 phosphorylation and its intrinsic acitivity. J Biol Chem 268: 3352-3356, 1993[Abstract/Free Full Text].

3.   Bradley, RL, and Cheatham B. Regulation of ob gene expression and leptin secretion by insulin and dexamethasone in rat adipocytes. Diabetes 48: 272-278, 1999[Abstract].

4.   Campfield, LA, Smith FJ, Guisez Y, Devos R, and Burn P. Recombinant mouse ob protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269: 546-549, 1995[Abstract/Free Full Text].

5.   Chen, H, Charlat O, Tartaglia LA, Woolf EA, Weng X, Ellis SJ, Lakey ND, Culpepper J, Moore KJ, Breitbart RE, Duuk GM, Tepper RI, and Morgenstern JP. Evidence that the Diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor in db/db mice. Cell 84: 491-495, 1996[ISI][Medline].

6.   Chua Jr, SC, Chung WK, Wu-Peng S, Zhang Y, Liu S-M, Tartaglia L, and Leibel RL. Phenotypes of mouse diabetes and rat fatty due to mutations in the OB (leptin) receptor. Science 271: 994-996, 1996[Abstract].

7.   Davis, LG, Dibner MD, and Battey JF. Basic Methods in Molecular Biology. New York: Elsevier, 1986, p. 264-273.

8.   Draznin, B, Kao M, and Sussman KE. Insulin and glyburide increase cytosolic free-Ca2+ concentration in isolated rat adipocytes. Diabetes 36: 174-178, 1987[Abstract].

9.   Draznin, B, Sussman KE, Eckel RH, Kao M, Yost R, and Sherman NA. Possible role of cytosolic free calcium concentrations in mediating insulin resistance of obesity and hyperinsulinemia. J Clin Invest 82: 1848-1852, 1988.

10.   Frederich, RC, Hamann A, Anderson S, Lollmann B, Lowell BB, and Flier JS. Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action. Nat Med 1: 1311-1314, 1995[ISI][Medline].

11.   Gaur, S, Morton ME, Frick P, and Goodman HM. Growth hormone regulates the distribution of L-type calcium channels in rat adipocyte membranes. Am J Physiol Cell Physiol 275: C505-C514, 1998[Abstract/Free Full Text].

12.   Gaur, S, Schweiger U, Tai L-H, Frick P, and Goodman HM. Insulin produces a growth hormone-like increase in intracellular free calcium concentration in okadaic acid-treated adipocytes. Endocrinology 139: 4953-4961, 1998[Abstract/Free Full Text].

13.   Halaas, JL, Boozer C, Blair-West J, Fidahusein N, Denton DA, and Friedman JM. Physiologic response to long-term peripheral and central leptin infusion in lean and obese mice. Proc Natl Acad Sci USA 94: 8878-8883, 1997[Abstract/Free Full Text].

14.   Harris, RBS, Ramsey TG, Smith SR, and Bruch RC. Early and late stimulation of ob mRNA expression in meal-fed and overfed rats. J Clin Invest 97: 2020-2026, 1996[ISI][Medline].

15.   Hirsch, J, and Gallian E. Methods for the determination of adipose cell size in man and animals. J Lipid Res. 9: 110-119, 1968[Abstract].

16.   Kelly, KL, Deeney JT, and Corkey BE. Cytosolic free calcium in adipocytes. J Biol Chem 264: 12754-12757, 1989[Abstract/Free Full Text].

17.   Levy, JR, LeGall-Salmon E, Santos M, Pandak WM, and Stevens W. Effect of enteral versus parenteral nutrition on leptin gene expression and release into the circulation. Biochem Biophys Res Commun 237: 98-102, 1997[ISI][Medline].

18.   MacDougald, OA, Hwang C, Fan H, and Lane MD. Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3-L1 adipocytes. Proc Natl Acad Sci USA 92: 9034-9037, 1995[Abstract/Free Full Text].

19.   Marshall, S. Kinetics of insulin receptor biosynthesis and membrane insertion: relationship to cellular function. Diabetes 32: 319-325, 1983[ISI][Medline].

20.   Masuzaki, H, Ogawa Y, Hosoda K, Kawada T, Fushiki T, and Nakao K. Augmented expression of the obese gene in the adipose tissue from rats fed high-fat diet. Biochem Biophys Res Commun 216: 355-358, 1995[ISI][Medline].

21.   Masuzaki, H, Ogawa Y, Sagawa N, Hosoda K, Matsumoto T, Mise H, Nishimura H, Yoshimasa Y, Tanaka I, Mori T, and Nakao K. Nonadipose tissue production of leptin: leptin as a novel placenta-derived hormone in humans. Nat Med 3: 1029-1033, 1997[ISI][Medline].

22.   Matschinsky, FM. A lesson in metabolic regulation inspired by the glucokinase glucose sensor paradigm. Diabetes 45: 223-241, 1996[Abstract].

23.   Matsumoto, SS, Raivio KO, and Seegmiller JE. Adenine nucleotide degradation during energy depletion in human lymphoblasts. J Biol Chem 254: 8956-8962, 1979[Abstract/Free Full Text].

24.   Mizuno, T, Bergen H, Kleopoulos S, Bauman WA, and Mobbs CV. Effects of nutritional status and aging on leptin gene expression in mice: importance of glucose. Horm Metab Res 28: 679-684, 1996[ISI][Medline].

25.   Mizuno, TM, Bergen H, Funabashi T, Kleopoulos SP, Zhong Y-G, Bauman WA, and Mobbs CV. Obese gene expression: Reduction by fasting and stimulation by insulin and glucose in lean mice, and persistent elevation in acquired (diet-induced) and genetic (yellow agouti) obesity. Proc Natl Acad Sci USA 93: 3434-3438, 1996[Abstract/Free Full Text].

26.   Mueller, WM, Gregoire FM, Stanhope KL, Mobbs CV, Mizuno TM, Warden CH, Stern JS, and Havel PJ. Evidence that glucose metabolism regulates leptin secretion from cultured rat adipocytes. Endocrinology 139: 551-558, 1998[Abstract/Free Full Text].

27.   Newgard, CB, and McGarry JD. Metabolic coupling factors in pancreatic beta -cell signal transduction. Annu Rev Biochem 64: 689-719, 1995[ISI][Medline].

28.   Ogawa, Y, Masuzaki H, Isse N, Okazaki T, Mori K, Shigemoto M, Satch N, Tamura N, Hosoda K, Yoshimasa Y, Jingami H, Kawada T, and Nakao K. Molecular cloning of rat obese cDNA and augmented gene expression in genetically obese zucker fatty (fa/fa) rats. J Clin Invest 96: 1647-1652, 1995.

29.   Pelleymounter, MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T, and Collins F. Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269: 540-543, 1995[Abstract/Free Full Text].

30.   Rentsch, J, Levens N, and Chiesi M. Recombinant ob-gene product reduces food intake in fasted mice. Biochem Biophys Res Commun 214: 131-136, 1995[ISI][Medline].

31.   Reusch, JEB, Begum N, Sussman KE, and Draznin B. Regulation of GLUT-4 phosphorylation by intracellular calcium in adipocytes. Endocrinology 129: 3269-3273, 1991[Abstract].

32.   Rodbell, M. Metabolism of isolated fat cells. I. Effects of hormones on glucose metabolism and lipolysis. J Biol Chem 239: 375-380, 1964[Free Full Text].

33.   Saladin, R, De Vos P, Guerre-Milo M, Leturque A, Girard J, Staels B, and Auwerx J. Transient increase in obese gene expression after food intake or insulin administration. Nature 377: 527-532, 1995[Medline].

34.   Segal, S, Lloyd S, Sherman N, Sussman K, and Draznin B. Postprandial changes in cytosolic free calcium and glucose uptake in adipocytes in obesity and non-insulin-dependent diabetes mellitus. Horm Res 34: 39-44, 1990[ISI][Medline].

35.   Spragg, RG, Hinshaw DB, Hyslop PA, Shraufstatter IU, and Cochrane CG. Alterations in adenosine triphosphate and energy charge in cultured endothelial and P388D1 cells after oxidant injury. J Clin Invest 76: 1471-1476, 1985.

36.   Thompson, MP. Meal-feeding specifically induces obese mRNA expression. Biochem Biophys Res Commun 224: 332-337, 1996[ISI][Medline].

37.   Vydelingum, S, Shillabeer G, Hatch G, Russell JC, and Lau DCW Overexpression of the obese gene in the genetically obese JCR:LA-corpulent rat. Biochem Biophys Res Commun 216: 148-153, 1995[ISI][Medline].

38.   Wang, JL, Liu R, Hawkins M, Barzilai N, and Rossetti L. A nutrient-sensing pathway regulates leptin gene expression in muscle and fat. Nature 393: 684-688, 1998[Medline].

39.   Weigle, DS, Bukowski TR, Foster DC, Holderman S, Kramer JM, Lasser G, Loften-Day CE, Prunkard DE, Raymond C, and Kuijper JL. Recombinant ob protein reduces feeding and body weight in the ob/ob mouse. J Clin Invest 96: 2065-2070, 1995.

40.   Zhang, Y, Proenca R, Maffel M, Barone M, Leopold L, and Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 372: 425-432, 1994[Medline].

41.   Zheng, D, Jones JP, Usala SJ, and Dohm GL. Differential expression of ob mRNA in rat adipose tissues in response to insulin. Biochem Biophys Res Commun 218: 434-437, 1996[ISI][Medline].


Am J Physiol Endocrinol Metab 278(5):E892-E901
0193-1849/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Evid Based Complement Alternat MedHome page
J. Z. Luo and L. Luo
American Ginseng Stimulates Insulin Production and Prevents Apoptosis through Regulation of Uncoupling Protein-2 in Cultured {beta} Cells
Evid. Based Complement. Altern. Med., September 1, 2006; 3(3): 365 - 372.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
P. G. Cammisotto, Y. Gelinas, Y. Deshaies, and L. J. Bukowiecki
Regulation of leptin secretion from white adipocytes by insulin, glycolytic substrates, and amino acids
Am J Physiol Endocrinol Metab, July 1, 2005; 289(1): E166 - E171.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. G. Cammisotto and L. J. Bukowiecki
Role of calcium in the secretion of leptin from white adipocytes
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2004; 287(6): R1380 - R1386.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. R. Levy and W. Stevens
Plasma hyperosmolality stimulates leptin secretion acutely by a vasopressin-adrenal mechanism
Am J Physiol Endocrinol Metab, August 1, 2004; 287(2): E263 - E268.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
P. K. Chelikani, D. H. Keisler, and J. J. Kennelly
Response of Plasma Leptin Concentration to Jugular Infusion of Glucose or Lipid Is Dependent on the Stage of Lactation of Holstein Cows
J. Nutr., December 1, 2003; 133(12): 4163 - 4171.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Gilbert, C. Magnan, S. Turban, J. Andre, and M. Guerre-Millo
Leptin Receptor-Deficient Obese Zucker Rats Reduce Their Food Intake in Response to a Systemic Supply of Calories From Glucose
Diabetes, February 1, 2003; 52(2): 277 - 282.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. Roh, J. Han, A. Tzatsos, and K. V. Kandror
Nutrient-sensing mTOR-mediated pathway regulates leptin production in isolated rat adipocytes
Am J Physiol Endocrinol Metab, February 1, 2003; 284(2): E322 - E330.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. R. Levy, B. Davenport, J. N. Clore, and W. Stevens
Lipid metabolism and resistin gene expression in insulin-resistant Fischer 344 rats
Am J Physiol Endocrinol Metab, March 1, 2002; 282(3): E626 - E633.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
T. S. Herrmann, M. L. Bean, T. M. Black, P. Wang, and R. A. Coleman
High Glycemic Index Carbohydrate Diet Alters the Diurnal Rhythm of Leptin But Not Insulin Concentrations
Experimental Biology and Medicine, December 1, 2001; 226(11): 1037 - 1044.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. R. Levy, J. Lesko, R. J. Krieg Jr., R. A. Adler, and W. Stevens
Leptin responses to glucose infusions in obesity-prone rats
Am J Physiol Endocrinol Metab, November 1, 2000; 279(5): E1088 - E1096.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow