|
|
||||||||
Department of Emergency Medicine, University of Tsukuba School of Medicine, Tsukuba, 305-8575 Japan
| |
ABSTRACT |
|---|
|
|
|---|
We investigated the
effect of hyperbaric oxygen treatment (HBO) on cytokine induction after
hemorrhage, because hypoxia induces cytokines in vitro. Chronically
cannulated conscious rats were subjected to 40 ml/kg of hemorrhage and
resuscitated with the shed blood and twice the volume of saline either
under room air (room air group) or under 100% oxygen at 3 atmospheres
absolute (hyperbaric group). Rats exposed to HBO with no hemorrhage
served as controls. Time course changes in plasma endotoxin level,
arterial ketone body ratio (AKBR), serum tumor necrosis factor (TNF),
interleukin-6 (IL-6), and their hepatic mRNA were detected in the three
groups. Plasma endotoxin levels increased significantly after
hemorrhage, and there were no significant differences between the room
air group and the hyperbaric group. In the room air group, AKBR dropped rapidly after hemorrhage and became minimal at hour 1, which
was associated with significant increases in TNF-
and IL-6 at both mRNA and circulating levels. HBO significantly attenuated decreases in
AKBR after hemorrhage with a significant reduction of mortality and
cytokine induction. These results indicate that HBO attenuated the
cytokine induction after hemorrhage by improving liver
ischemia, and they suggest that tissue hypoxia may be
responsible, at least in part, for cytokine induction after massive hemorrhage.
hemorrhagic shock; hypoxia; tumor necrosis factor; interleukin-6
| |
INTRODUCTION |
|---|
|
|
|---|
CYTOKINES ARE SMALL POLYPEPTIDES or glycoproteins
serving in the intercellular signaling pathways. They affect growth and metabolism, acting mainly in a paracrine and/or autocrine manner. In
responding to external stimuli, vertebrates set in motion molecular and
cellular interactions to facilitate a return to physiological homeostasis, and cytokines are deeply involved in these complex interactions. Tumor necrosis factor alpha (TNF-
) and interleukin-6 (IL-6) are proinflammatory cytokines and have great influence on
temporal and spatial patterns of inflammatory responses. Release of
these inflammatory cytokines into the local tissue milieu enhances antimicrobial function and helps tissue repair, but their
overproduction after hemorrhagic shock may cause tissue injury (2, 29). Therefore, elucidation of the mechanism whereby cytokine induction occurs after massive hemorrhage may provide new prospects in the treatment of hemorrhage-related disorders. Several factors, including hypoxia, neuroendocrine release, and endotoxemia, have been implicated in cytokine induction after hemorrhage, but the precise mechanism is
still unknown (6).
During the 1960s, there was widespread enthusiasm for hyperbaric oxygen
treatment (HBO) for various diseases, including myocardial infarction,
stroke, senility, and cancer. Enthusiasm waned after results of
clinical trials showed little benefit for these diseases, and now the
overzealous claims about the effectiveness of HBO have a legacy of
skepticism among physicians. However, animal studies and clinical
trials over the last two decades have produced a set of indications for
which HBO may be beneficial (9). Under 100% oxygen at 3 atmospheres
absolute (ata), the arterial oxygen tension would be over 2,000 mmHg,
or an increase of about 6 vol% of arterial oxygen, which should
provide enough oxygen to tissues, even in the total absence of
hemoglobin (3). Therefore, HBO may effect cytokine induction after
massive hemorrhage, if tissue hypoxia is involved in the induction. In
this study, chronically cannulated conscious rats were divided into
three groups, and time course changes in plasma endotoxin level,
arterial ketone body ratio (AKBR), serum TNF and IL-6, and hepatic mRNA
of TNF-
and IL-6 were detected. The three groups were the RA group
(40 ml/kg hemorrhage over 1 h under room air without HBO), the HB group
(40 ml/kg hemorrhage over 1 h with HBO), and the NH group (HBO with no
hemorrhage). We compared the changes among the three groups and
examined the effect of HBO on the cytokine induction after massive hemorrhage.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animal preparation. Male Wistar rats (Charles River, Tsukuba, Japan) weighing 290-310 g were anesthetized with pentobarbital sodium (50 mg/kg ip), and femoral arterial and venous cannulas were placed using sterile procedures, as previously described (7). After recovery, all rats were housed individually in a temperature-controlled environment with a 12:12-h light-dark cycle and were allowed to move freely. Access to food and water was given ad libitum. On the morning of the fourth day after cannulation, the following three experiments were begun. All the experiments were approved by the Animal Care Committee of the University of Tsukuba.
Experiment 1. To detect the changes in mean arterial blood pressure (MABP) after hemorrhage, five conscious rats were subjected to a total of 12 ml (40 ml/kg) hemorrhage under room air (7 ml at time 0, followed by 0.5 ml each at minutes 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60). Rats were bled by drawing blood manually into a plastic syringe containing 30 units of heparin sodium. Then, rats were resuscitated with the shed blood and two times the volume of saline at hours 1 and 4. MABP was measured continuously by connecting the femoral arterial cannula to a high-pressure transducer [Gould, Oxnard, CA (29)].
Experiment 2.
Thirty chronically cannulated conscious rats were divided into three
groups (n = 10 for each group), and survival rate and changes
in AKBR and plasma endotoxin level were detected. The RA and HB groups
were subjected to 40 ml/kg of hemorrhage and then resuscitated by the
same protocol as in experiment 1. The HB and NH groups were
exposed to HBO individually in a 15.2-liter hyperbaric chamber for
animal experiments (P-5100S; Hanyuda, Tokyo, Japan) by the following
protocol: 1) denitrogenation by flushing with 2 l/min of 100%
oxygen from minute
20 to minute
15;
2) pressurization to 3 ata 100% oxygen from minute
15 to time 0; 3) 100% oxygen at 3 ata from
time 0 to minute 60, a constant flow of 0.5 l/min of
oxygen being employed to prevent the accumulation of carbon dioxide;
4) decompression from minute 60 to minute 90. The chamber has a small side hole through which the arterial and venous
catheters were exteriorized. The survival rate was determined 24 h
after hemorrhage. At time 0 and at hours 1, 2, 4, and 6, 0.5 ml of blood was withdrawn from the arterial
catheter, cooled in ice immediately, and centrifuged at 4°C for
measurement of AKBR and plasma endotoxin level. An equal volume of
saline was replaced every time 0.5 ml of blood was withdrawn for assay.
Acetoacetate (AcAc) and
-hydroxybutyrate (BOH) in the plasma were
measured enzymatically with a Ketorex kit (Sanwa Kagaku Kenkyusho,
Nagoya, Japan) using a semiautomated measuring system (Keto-340; Ihara Electronic Kasugai, Japan). AKBR was calculated as AcAc divided by BOH
(16). Plasma endotoxin levels were assayed by a colorimetric limulus
test using a limulus amoebocyte lysate and a chromogenic substrate
(Endotoxin Test D; Seikagaku, Tokyo, Japan) (18). To remove interfering
factors, 0.1 ml of 0.32 M perchloric acid was added to 0.05 ml of
plasma in an ice bath, and the mixture was incubated at 37°C for 20 min. The denatured material was precipitated by centrifugation at 3,000 rpm for 15 min, and the supernatant was neutralized with an equal
volume of 0.18 N NaOH and was used for the colorimetric test. The
detection limit was 2 pg/ml by this method. The plasma taken at
hour 1 was also used for measurement of corticosterone B
levels. After extraction with ether and separation by Sephadex LH-20
microcolumn chromatography (Amersham Pharmacia Biotech, Little
Chalfont, UK), plasma B levels were determined by RIA using rabbit
antiserum against corticosterone-21 BSA (17). The assay sensitivity was
0.5 µg/dl.
Experiment 3.
Seventy-five chronically cannulated conscious rats were divided into
three groups, and time course changes in serum TNF, serum IL-6, hepatic
TNF-
mRNA, and hepatic IL-6 mRNA were detected. The protocols of
hemorrhage and HBO were the same as in experiments 1 and
2. Rats were subjected to blood sampling (0.5 ml) only once at
the designated time for measurement of serum TNF and IL-6 levels, and
an equal volume of saline was replaced immediately after blood sampling. Then the rats were killed, and the livers were removed and
snap-frozen in liquid nitrogen for extraction of total cellular RNA
(n = 5 livers for each time point). For time 0 in the
HB and NH groups, rats were killed after flushing with 100% oxygen
from minute
20 to time 0; therefore, the
time 0 rats were not exposed to 3 ata. For hour 1, rats
were exposed to 3 ata 100% oxygen from time 0 to minute
30 and then decompressed from minute 30 to minute 60; therefore, the hour 1 rats in the HB and NH groups were
exposed to 3 ata for 30 min.
(Asahi-Kasei, Tokyo, Japan) as a standard and expressed as picograms
per milliliter. The sensitivity of this bioassay was 10 pg/ml. The
serum IL-6 level was determined as hybridoma growth factor using
MH60.BSF2 cells, as previously described (15). Serum IL-6 levels were
calculated using recombinant human IL-6 (Fuji-Rebio, Tokyo, Japan) as a
standard and expressed as picograms per milliliter. The sensitivity of
this bioassay was 20 pg/ml.
Messenger RNA of TNF-
and IL-6 was measured semiquantitatively by
reverse transcription and PCR, as previously described (28-30).
Briefly, the first strand of cDNA was synthesized by RT (MMLV-RT; GIBCO
BRL, Rockville, MD), and the resulting cDNA samples were adjusted to
PCR buffer conditions. A three-temperature step PCR cycle program
was carried out with an OmniGene Temperature Cycler (Hybaid,
Middlesex, UK) by 40 s of annealing at 68°C, 1 min of extension at
72°C, and 1 min of denaturation at 94°C. After PCR, the products
were quantitated by HPLC, as previously described (28). An
endotoxin-treated rat, killed 2 h after 100 µg/kg intravenous endotoxin, was used as a positive control (Escherichia coli
lipopolysaccharide, serotype 0111: B4; Sigma, St. Louis, MO).
Twenty-five to thirty-five PCR cycles were run to determine
the dependency of the amount of PCR products on cycle numbers.
Linearity between the amount of amplified cDNA and that of applied RNA
was checked in the preplateau exponential phase. The relative
multiple increases in TNF-
and IL-6 mRNA at each time point after
hemorrhage compared with the level of normal untreated rats
were determined after normalization for
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. The primers were 5'CACCACGCTCTTCTGTCTACTGAAC and
5'CCGGACTGCGTGATGTCTAAGTACT for TNF-
, 5'GACTGATGTTGTTGACAGCCACTGC
and 5'TAGCCACTCCTTCTGTGACTCTAACT for IL-6, and
5'TGATGACATCAAGAAGGTGGTGAAG and 5'TCCTTGGAGGCCATGTAGGCCAT for
GAPDH (28, 30). The lengths of the PCR products were 546, 509, and
240 base pairs for TNF-
, IL-6, and GAPDH, respectively.
Statistics.
Data were analyzed by two-way ANOVA in experiment 3 and were
analyzed by two-way ANOVA corrected for repeated measures over time in
experiments 1 and 2. Differences among the RA, HB, and NH groups at the individual time points were analyzed with the Newman-Keuls test after two-way ANOVA. Differences between the baseline
levels and the individual time points were also analyzed with the
Newman-Keuls test after ANOVA. Survival rate was compared by
2-test among the three groups. Significant differences
are indicated (P < 0.05).
| |
RESULTS |
|---|
|
|
|---|
Experiment 1.
Forty milliliters per kilogram hemorrhage caused a prompt decrease in
MABP under room air (Fig. 1A). MABP
was maintained at between 35 and 45 mmHg for the first 60 min and then
recovered gradually during fluid resuscitation. MABP stabilized below
the prehemorrhage level after fluid resuscitation.
|
Experiment 2. All rats survived for 6 h after hemorrhage. In the RA group, 6 out of 10 rats died within 24 h, whereas only one rat died in the HB group, and no rats died in the NH group. The survival rate in the RA group was thus significantly lower than the rates in the HB and NH groups. In the NH group, no significant changes were detected either in plasma endotoxin level or AKBR compared with the baseline levels. In the RA and HB groups, plasma endotoxin levels increased significantly after hemorrhage and peaked at hour 2; there were no significant differences between the RA and HB groups at any time points (Fig. 1B). In the RA group, AKBR dropped rapidly after hemorrhage and became minimal at hour 1. Both AcAc and BOH decreased, but AcAc decreased more profoundly (data not shown). AKBR recovered slowly during fluid resuscitation and then decreased again in the RA group (Fig. 1C). BOH remained low, and the recovery of AKBR was due to an increase in AcAc (data not shown). These decreases in AKBR after hemorrhage were attenuated by HBO, and the difference between the RA and HB groups was significant at hour 1. Plasma B levels at hour 1 were 45 ± 7, 43 ± 8, and 9 ± 4 µg/dl in the RA, HB, and NH groups, respectively. The plasma B level in the NH group was significantly lower than in the other two groups, but the difference between the RA and HB groups was not significant.
Experiment 3.
When reverse-transcribed RNA from an endotoxin-treated rat was
subjected to an increasing number of PCR cycles, a period of exponential increase in PCR products was followed by a period of
saturation between 25 and 35 cycles (data not shown). Good linearity
between the amount of reverse-transcribed RNA and that of the resulting
PCR product was acquired over a range of 0.0125 to 0.2 µg at 29 and
27 PCR cycles for TNF-
and IL-6, respectively (data not shown). All
further PCR experiments were performed using 0.2 µg of
reverse-transcribed RNA at these PCR cycles.
mRNA and serum TNF level increased significantly after
hemorrhage in the RA group and peaked at hours 2 and 4,
respectively (Fig. 2). These increases were
attenuated by HBO, and the differences between the RA and HB groups
were significant at hours 1 and 2 for TNF-
mRNA and
at hour 4 for serum TNF level. Hepatic IL-6 mRNA and serum IL-6
levels also increased significantly after hemorrhage in the RA group
(Fig. 3). These increases were attenuated
by HBO, and the differences between the RA and HB groups were
significant at hours 4 and 6 for IL-6 mRNA and at
hour 6 for serum IL-6 levels. In the NH group, no significant
changes were detected in either serum TNF or IL-6. TNF-
mRNA and
IL-6 mRNA showed small increases after HBO in the NH group, but these changes were not significant compared with the baseline levels.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Various endocrine and metabolic responses are induced after hemorrhage
to maintain the constancy of the internal environment, and induction of
cytokines to hemorrhage is one of these host defense responses. After
moderate hemorrhage, restitution of blood volume can be accomplished by
movement of fluids in the interstitium or cells to the effective
circulating volume (8). After massive hemorrhage, however, cell
swelling may occur, and the blood volume restitution may be impaired,
resulting in the disturbance of tissue perfusion, which further
exacerbates tissue hypoxia. The exact mechanism whereby cell swelling
occurs after massive hemorrhage is not yet determined, but the most
accepted view is that cell swelling results from a failure of oxygen
delivery (23). According to this view, as oxygen delivery fails, cells
are unable to generate sufficient quantities of ATP; as a result, the
electrogenic sodium pump, mediated by the hydrolysis of ATP, fails, and
cell swelling occurs. Excessive induction of inflammatory cytokines may
follow this state and lead to further deterioration of organ functions (2). An in vitro study has shown that hypoxia increases TNF-
secretion by macrophages (21). It is possible that tissue hypoxia also
triggers overproduction of inflammatory cytokines in vivo. If rats are
subjected to massive hemorrhage under 100% oxygen at 3 ata, tissue
hypoxia after hemorrhage should be attenuated, because fluids in the
interstitium and cells contain enough oxygen. This attenuation may
block cell swelling and thereby inhibit further deterioration of tissue
oxygenation. In this study, HBO significantly attenuated decreases in
AKBR after hemorrhage, with a significant reduction in mortality and
cytokine induction. Although we could not directly measure oxygen
utilization or oxygen content in the liver in this study, the results
suggest that HBO attenuated cytokine induction after hemorrhage by
improving liver ischemia. These results indicate that tissue
hypoxia may be responsible, at least in part, for cytokine induction
after massive hemorrhage.
Because the liver plays a crucial role in recovery from shock, it is
desirable to know the degree of metabolic disturbances in the liver
after hemorrhagic shock, but conventional chemical measurements give
little information regarding energy production. AKBR is a ratio of AcAc
to BOH in arterial blood and well reflects the hepatic mitochondrial
redox state. Many studies have shown that AKBR provides accurate
information about the degree of liver ischemia after massive
hemorrhage (16). The redox state in mitochondria is normally maintained
reduced under conditions of normal oxygen delivery to the mitochondria.
However, if oxygen delivery decreases, the mitochondrial redox state
becomes highly reduced because of the decreased oxidation of NADH to
NAD+. In this state, the entry of pyruvate into the
mitochondria and its conversion to acetyl-CoA and the entry of
acetyl-CoA into the tricarboxylic acid cycle are inhibited, resulting
in severe impairment of energy production. In 1967, Krebs et al. showed that the NAD+-to-NADH ratio in liver mitochondria parallels
the AcAc-to-BOH ratio (25). Although it is difficult to measure the
AcAc-to-BOH ratio in the mitochondria, the ratio in the hepatic venous
blood is expected to reflect that in the liver mitochondria, because ketone bodies are produced only in the liver and pass freely through the mitochondrial and cell membranes. Moreover, it was shown that the
AcAc-to-BOH ratio in the peripheral arterial blood correlates well with
that in the hepatic venous blood (26). Therefore, we can assess the
redox state and the degree of impairment of energy production during
hemorrhagic shock by measuring the AcAc-to-BOH ratio in the peripheral
arterial blood, i.e., AKBR. The mitochondrial redox state of
NAD+ is correlated with the cytoplasmic redox state, and
the latter is in equilibrium with the pyruvate-to-lactate ratio (25).
Although the pyruvate-to-lactate ratio in liver tissue correlates well with the hepatic redox state and the energy charge, the
pyruvate-to-lactate ratio in the peripheral blood does not seem to
correlate well with them (26). This is due to the fact that glycolysis
occurs not only in the liver but also in other organs. Moreover, during shock, lactate produced in the peripheral tissues may not be
transported to the liver. Thus the redox state in the liver under
hemorrhagic shock correlates better with the arterial AcAc-to-BOH ratio
than does the pyruvate-to-lactate ratio, and a reduction in oxygen delivery seems to be mainly responsible for a decrease of AKBR after
hemorrhage. A change in pH is also a potent perturbing factor of AKBR,
because pH changes the equilibrium constant of the
-hydroxybutyrate dehydrogenase system (25). Although we could not measure pH in the
liver, pH may have affected AKBR in this study.
In previous studies, we had performed hemorrhagic shock experiments by fixing MABP at 40 mmHg for 60 min (27, 28), but in this experiment, we adopted a fixed-volume model because we could not measure the blood pressure within a hyperbaric chamber. The blood pressure transducer we used in this study has a closed membrane, and therefore, when it was placed in the chamber, it was damaged as the pressure in the chamber increased. Calibration in the chamber was also impossible. Formerly, we had a chance to detect the changes in blood pressure during 20 ml/kg hemorrhage under HBO (unpublished data). In that experiment, we introduced an anesthetized rabbit into a bigger oxygen chamber and measured the blood pressure directly by the height of the blood in the cannula connected to the femoral artery. In that study, MABP was higher by 5-10 mmHg than that of a rabbit bled under room air. Therefore, the favorable effect of HBO on the circulatory system may also contribute to its efficacy. In this study, the blood variables returned to near baseline at hour 4. Hemodilution from the infused fluid may have had some effect on this return, because infusion was done between hours 1 and 4. However, after 20 ml/kg hemorrhage without fluid resuscitation, hepatic cytokine mRNA also returned to near-normal level at hour 4 (29), and AKBR recovered within 2 h in reversible shock models of rats (26). Therefore, the return of the blood variables at hour 4 seems to be basically a physiological response rather than a dilution effect.
Factors other than tissue hypoxia, such as neuroendocrine release and
endotoxemia, have been implicated in cytokine induction after massive
hemorrhage (6). Circulating levels of glucocorticoid and epinephrine
increase rapidly after hemorrhage, and a complex communication seems to
exist between the neuroendocrine and the immune systems (13). Komaki et
al. (10) showed that there is an inverse relationship between IL-6 and
B concentrations in hemorrhaged rats (30% of the total blood) by use
of adrenalectomy and B replacement, and they suggested the possibility
that the neuroendocrine system has some regulatory effect on cytokine
induction after hemorrhage. In this study, however, plasma B level at
the maximum bleedout point was not significantly different between the
RA and HB groups. Pharmacological studies have shown that administration of either glucocorticoid or epinephrine has no effect or
even suppresses the induction of inflammatory cytokines (12, 24).
Therefore, the neuroendocrine response does not seem to be the main
factor that induces inflammatory cytokines after hemorrhage, although
its regulatory effect cannot be ruled out. Lactic acid accumulates in
tissues where metabolic demand exceeds oxygen supply, and it was shown
that addition of lactate to cultured macrophages stimulates the release
of an angiogenic factor (19). Reduction of lactate level by HBO may
also contribute to its effect on cytokine induction. Endotoxin is a
strong inducer of cytokines both in vitro and in vivo. Bogin et al. (4)
showed that HBO improves both mortality and morbidity in rabbits
treated with Shigella endotoxin. There is a possibility that HBO
affects cytokine induction after endotoxin treatment in vivo. In our
previous study, treatment with bactericidal/permeability-increasing
protein partially inhibited induction of TNF-
mRNA and IL-6 mRNA in
rat liver 8 h after hemorrhagic shock but did not attenuate the
induction at hours 1 and 6 (27). Endotoxemia seems to play a
role, especially in the late-phase induction of inflammatory cytokines
after hemorrhagic shock. In this study, the plasma endotoxin levels
were not significantly different between the RA and HB groups, whereas
an early cytokine induction was significantly attenuated by HBO. These
results suggest that tissue hypoxia may be another mechanism by which
cytokine induction occurs after massive hemorrhage. On the other hand, a recent study has shown that hyperoxia activates the nuclear transcription factor and increases TNF-
gene expression in mouse pulmonary lymphocytes by producing reactive oxygen intermediates (22).
In this study, mRNA of TNF-
and IL-6 showed gradual increases after
HBO in the HB and NH groups. Reactive oxygen intermediates may also be
involved in cytokine induction after hemorrhage, especially in the
reperfusion stage after ischemia. Interestingly, HBO diminished TNF-
secretion from rat macrophages stimulated with endotoxin in the
study of Lahat et al. (11) and decreased mortality in the
zymosan-induced shock model of rats with a marked reduction of serum
TNF-
levels in the study of Luongo et al. (14). It seems that HBO
brings about cytokine induction in the normal state but inhibits it in
stress conditions. Luongo et al. suggested that HBO might act as an
immune modulator, but the precise mechanism was unknown.
It was reported as early as in 1939 that administration of oxygen is effective for shock (5), and this effect was confirmed by many other researchers. In 1964, Blair et al. (3) first showed that the survival rate after hemorrhagic shock was significantly improved by HBO. In their study, dogs were transferred to a hyperbaric chamber after stabilization of MABP at 30 mmHg for 30 min, and fluid resuscitation was begun after 2 h of HBO. By their protocol, the survival rate was improved 17-74%. In this study, rats were subjected to 40 ml/kg hemorrhage after introduction of HBO to negate the effects of tissue hypoxia. In clinical settings, however, HBO should be applied after hemorrhage. To examine the efficacy of HBO as a treatment for hemorrhagic shock, other protocols, i.e., posttreatment, must be tried with a combination of various forms of fluid resuscitation.
In this study, we detected the changes in cytokine mRNA in total
homogenates of the liver, and the cell types responsible for cytokine
production in the liver were not examined. Because hypoxia increases
TNF-
production by macrophages in vitro, it is quite possible that
Kupffer cells in the liver produce cytokines after massive hemorrhage.
However, overlying hepatocytes and endothelial cells also seem to
produce cytokines in sepsis models of rats (1). The cellular
localization of cytokine production in the liver after massive
hemorrhage still needs to be elucidated.
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: M. Yamashita, Department of Emergency Medicine, University of Tsukuba School of Medicine, 1-1-1, Tennodai, Tsukuba, 305-8575 Japan.
Received 29 July 1999; accepted in final form 7 December 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Andrejko, KM,
and
Deutschman CS.
Acute-phase gene expression correlates with intrahepatic tumor necrosis factor-
abundance but not with plasma tumor necrosis factor concentrations during sepsis/systemic inflammatory response syndrome in the rat.
Crit Care Med
24:
1947-1952,
1996[ISI][Medline].
2.
Barahmi, S,
Yao YM,
Leichtfried G,
Redl H,
Marzi I,
and
Schlag G.
Significance of TNF in hemorrhage-related hemodynamic alterations, organ injury, and mortality in rats.
Am J Physiol Heart Circ Physiol
272:
H2219-H2226,
1997
3.
Blair, E,
Henning G,
Esmond WG,
Attar S,
Cowley RA,
and
Michaelis M.
The effect of hyperbaric oxygenation (OHP) on three forms of shock
traumatic, hemorrhagic, and septic.
J Trauma
4:
652-663,
1964.
4.
Bogin, IB,
Belavina MV,
Koloskov YB,
Demurov EA,
Leonova SF,
Khitrov NK,
and
Efuni SN.
Changes in the properties of plasma fibronectin in Shigella-induced endotoxemia and the responses to hyperbaric oxygenation and indomethacin.
Biomed Sci Instrum
1:
605-609,
1990.
5.
Boothby, WM,
Mayo CW,
and
Love WR.
One hundred per cent oxygen: indications for its use and method of its use.
JAMA
113:
477-482,
1939.
6.
Chaudry, IH,
Ayala A,
Ertel W,
and
Stephan RN.
Hemorrhage and resuscitation: immunological aspects.
Am J Physiol Regulatory Integrative Comp Physiol
259:
R663-R678,
1990
7.
Darlington, DN,
Keil LC,
and
Dallman MF.
Potentiation of hormonal response to hemorrhage and fasting, but no hypoglycemia in conscious adrenalectomized rats.
Endocrinology
125:
1398-1406,
1989[Abstract].
8.
Gann, DS,
and
Foster AH.
Endocrine and metabolic responses to injury.
In: Principles of Surgery (9th ed.), edited by Schwartz SI,
Shires GT,
and Spencer FC.. New York, NY: McGraw Hill, 1994, p. 3-59.
9.
Grim, PS,
Gottlieb LJ,
Boddie A,
and
Batson E.
Hyperbaric oxygen therapy.
JAMA
263:
2216-2220,
1990[Abstract].
10.
Komaki, G,
Gottschall PE,
Somogyvari-Vigh A,
Tatsuno I,
Yatohgo T,
and
Arimura A.
Rapid increase in plasma IL-6 after hemorrhage, and posthemorrhage reduction of the IL-6 response to LPS in conscious rats: interrelation with plasma corticosterone levels.
Neuroimmunomodulation
1:
127-134,
1994[Medline].
11.
Lahat, N,
Bitterman H,
Yaniv N,
Kinarty A,
and
Bitterman N.
Exposure to hyperbaric oxygen induces tumor necrosis factor-alpha (TNF-
) secretion from rat macrophages.
Clin Exp Immunol
102:
655-659,
1995[ISI][Medline].
12.
Liao, J,
Keiser JA,
Scales WE,
Kunkel SL,
and
Kluger MJ.
Role of epinephrine in TNF and IL-6 production from isolated perfused rat liver.
Am J Physiol Regulatory Integrative Comp Physiol
268:
R896-R901,
1995
13.
Lilly, MP,
and
Gann DS.
The hypothalamic-pituitary-adrenal-immune axis.
Arch Surg
127:
1463-1474,
1992[Abstract].
14.
Luongo, C,
Imperatore F,
Cuzzocrea S,
Filippelli A,
Scafuro MA,
Mangoni G,
Portlano F,
and
Rossi F.
Effects of hyperbaric oxygen exposure on zymosan-induced shock model.
Crit Care Med
26:
1972-1976,
1998[ISI][Medline].
15.
Matsuda, T,
Hirano T,
and
Kishimoto T.
Establishment of an interleukin 6 (IL 6)/B cell stimulatory factor 2-dependent cell line and preparation of anti-IL 6 monoclonal antibodies.
Eur J Immunol
18:
951-956,
1988[ISI][Medline].
16.
Nakatani, T,
Spolter L,
and
Kobayashi K.
Arterial ketone body ratio as a parameter of hepatic mitochondrial redox state during and after hemorrhagic shock.
World J Surg
19:
592-596,
1995[ISI][Medline].
17.
Nishida, S,
Matsumura S,
Horino M,
Oyama H,
and
Tenku A.
A radioimmunoassay for human plasma corticosterone.
Endocrinol Jpn
23:
465-469,
1976[Medline].
18.
Obayashi, T.
Addition of perchloric acid to blood samples for colorimetric limulus test using chromogenic substrate.
J Lab Clin Med
104:
321-330,
1984[ISI][Medline].
19.
Paty, PB,
Banda MJ,
and
Hunt TK.
Activation of macrophages by L-lactic acid.
Surg Forum
39:
27-28,
1988.
20.
Ruff, MR,
and
Gifford GE.
Purification and chemical characterization of rabbit tumor necrosis factor.
J Immunol
125:
1671-1677,
1980[Abstract].
21.
Scannell, G,
Waxman K,
Kaml GJ,
Ioli G,
Gatanaga T,
Yamamoto R,
and
Granger GA.
Hypoxia induces a human macrophage cell line to release tumor necrosis factor-
and its soluble receptors in vitro.
J Surg Res
54:
281-285,
1993[ISI][Medline].
22.
Shea, LM,
Beehler C,
Schwartz M,
Shenkar R,
Tuder R,
and
Abraham E.
Hyperoxia activates NF-
B and increases TNF-
and IFN-
gene expression in mouse pulmonary lymphocytes.
J Immunol
157:
3902-3908,
1996[Abstract].
23.
Shires, GT, III,
Shires GT,
and
Carrico CJ.
Shock.
In: Principles of Surgery (9th ed.), edited by Schwartz SI,
Shires GT,
and Spencer FC.. New York, NY: McGraw-Hill, 1994, p. 119-144.
24.
Snyder, DS,
and
Unanue ER.
Corticosteroids inhibit murine macrophage Ia expression and interleukin production.
J Immunol
129:
1803-1805,
1982[Abstract].
25.
Williamson, DH,
Lund P,
and
Krebs HA.
The redox state of free nicotinamide-adenosine dinucleotide in the cytoplasm and mitochondria of rat liver.
Biochem J
103:
514-527,
1967[ISI][Medline].
26.
Yamamoto, M,
Tanaka J,
Ozawa K,
and
Tobe T.
Significance of acetoacetate/
-hydroxybutyrate ratio in arterial blood as an indicator of the severity of hemorrhagic shock.
J Surg Res
28:
124-131,
1980[ISI][Medline].
27.
Yamashita, M.
Bactericidal/permeability-increasing protein ameliorates hypercoagulability after hemorrhagic shock.
Thromb Res
87:
323-329,
1997[ISI][Medline].
28.
Yamashita, M,
Darlington DN,
Weeks EJ,
Jones RO,
and
Gann DS.
Plasminogen activator inhibitor-1 rises after hemorrhage in rats.
Am J Physiol Endocrinol Metab
268:
E1065-E1069,
1995
29.
Yamashita, M,
Tanaka J,
and
Yamashita M.
Cytokine mRNA expression after transient and prolonged hypotension.
Surg Today
27:
159-162,
1997[ISI][Medline].
30.
Yamashita, M,
and
Yamashita M.
Responses of hepatic TNF-
mRNA to repeated hemorrhage in the conscious rat.
Am J Physiol Endocrinol Metab
275:
E27-E31,
1998
This article has been cited by other articles:
![]() |
J. Alex, G. Laden, A. R.J. Cale, S. Bennett, K. Flowers, L. Madden, E. Gardiner, P. T. McCollum, and S. C. Griffin Pretreatment with hyperbaric oxygen and its effect on neuropsychometric dysfunction and systemic inflammatory response after cardiopulmonary bypass: A prospective randomized double-blind trial J. Thorac. Cardiovasc. Surg., December 1, 2005; 130(6): 1623 - 1630. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |