|
|
||||||||
Clinical Nutrition Research Unit, Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15213
| |
ABSTRACT |
|---|
|
|
|---|
Rat cardiac and
skeletal muscles, which have been used as model tissues for studies of
regulation of branched-chain
-keto acid (BCKA) oxidation, vary
greatly in the activity state of their BCKA dehydrogenase. In the
present experiment, we have investigated whether they also vary in
response of their BCKA dehydrogenase to a metabolic alteration such as
diabetes and, if so, to investigate the mechanism that underlies the
difference. Diabetes was produced by depriving streptozotocin-treated
rats of insulin administration for 96 h. The investigation of BCKA
dehydrogenase in the skeletal muscle (gastrocnemius) showed that
diabetes 1) increased its activity, 2) increased the protein and gene
expressions of all of its subunits (E1
,
E1
,
E2),
3) increased its activity state,
4) decreased the rate of its
inactivation, and 5) decreased the
protein expression of its associated kinase (BCKAD kinase) without
affecting its gene expression. In sharp contrast, the investigation of
BCKA dehydrogenase in the cardiac muscle showed that diabetes
1) decreased its activity,
2) had no effect on either protein
or gene expression of any of its subunits,
3) decreased its activity state,
4) increased its rate of
inactivation, and 5) increased both
the protein and gene expressions of its associated kinase. In
conclusion, our data suggest that, in diabetes, the protein expression
of BCKAD kinase is downregulated posttranscriptionally in the skeletal muscle, whereas it is upregulated pretranslationally in the cardiac muscle, causing inverse alterations of BCKA dehydrogenase activity in
these muscles.
branched-chain keto acid dehydrogenase; BCKAD kinase
| |
INTRODUCTION |
|---|
|
|
|---|
MUSCLES PLAY A MAJOR ROLE in oxidation of branched-chain amino acids (2). These amino acids (leucine, isoleucine, and valine) combined are the major constituents of dietary and body proteins. Transamination of these amino acids results in production of branched-chain keto acids (BCKA). The key enzyme regulating oxidation of these keto acids is BCKA dehydrogenase. It exists in interconvertible phosphorylated (inactive) and dephosphorylated (active) forms (32).
Previous studies from our laboratory (27, 28, 31) and others (3, 11, 26) have shown that the activity of BCKA dehydrogenase in muscles is greatly altered in metabolic disorders such as diabetes. However, there have been very few studies on the mechanism of these alterations in the muscle. The only mechanism that has been implicated is changes in the activity state (proportion of active to inactive form) of the enzyme (3, 11, 26, 31). On the other hand, studies in the liver have shown that there are other mechanisms responsible for alteration of BCKA dehydrogenase activity. For example, Chicco et al. (7) found that dexamethasone and cAMP treatment increases the amount of BCKA dehydrogenase in primary cultured hepatocytes by increasing its gene expression without a significant change in the activity state of BCKA dehydrogenase. As yet, there has not been any study on the effect of diabetes on molecular expressions of any component of BCKA dehydrogenase complex in muscles. Therefore, an aim of the present study was to fill this gap in the current knowledge.
There is another compelling reason for investigating the mechanisms of alterations of BCKA dehydrogenase activity in muscles. Although both the cardiac and skeletal muscles have been used for studies of regulation of muscle BCKA oxidation (5, 13, 14), they differ greatly in the activity state of their BCKA dehydrogenase. The enzyme is substantially active in the cardiac muscle (11, 26), whereas it is almost totally inactive in the resting skeletal muscle (3, 33). This raises the possibility that these muscles respond differently to metabolic alterations. Therefore, another aim of the present study was to investigate this possibility by determining whether diabetes has the same or different effects on BCKA dehydrogenase activity in the cardiac and skeletal muscles and to determine the mechanisms underlying these effects. These studies were performed in the muscles of streptozotocin-treated rats deprived of insulin administration for 96 h before experiments.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animals and their treatment. Twenty rats (male Sprague-Dawley, 200-250 g) were made diabetic and another twenty served as the control group. Rats were housed in individual cages in air-conditioned quarters with a controlled 12:12-h light-dark cycle and received powdered Purina Laboratory Chow and drinking water ad libitum. Diabetes was induced by intraperitoneal injection of streptozotocin (85 mg/kg body weight) in 0.05 M citrate-buffered saline, pH 4.5. Control rats were given a citrate-buffered saline injection. Induction of diabetes was assessed by estimation of blood glucose. Blood samples were collected in heparinized tubes and immediately centrifuged. Plasma was separated, and blood glucose was determined by the glucose oxidase method (43). Diabetic rats (>2+ glucosuria) received a daily injection of insulin (Humulin U Ultralente; Eli Lilly, Indianapolis, IN), 2-3 U/day for 8-10 days. At the end of this period, insulin therapy was withdrawn, and all the rats were euthanized ~96 h after the last insulin injection. During all periods, dietary treatment was maintained as described above. This protocol was similar to the one we previously used for studies of leucine oxidation and BCKA dehydrogenase in diabetic rats (22, 27, 28, 31).
Assay of BCKA dehydrogenase activity.
The gastrocnemius and cardiac muscles were freeze-clamped with
Wollenberger clamps precooled in liquid nitrogen. BCKA dehydrogenase complex was extracted from frozen tissues by a polyethylene
glycol (PEG) precipitation method, as described previously
(33). The activity of BCKA dehydrogenase in the cardiac muscle was
determined spectrophotometrically by measuring the reduction of
NAD+ (7). The complete assay
mixture contained (final volume 1.5 ml) 30 mM potassium phosphate
buffer (pH 7.4), 3 mM NAD+, 0.4 mM
CoASH, 0.4 mM thiamine pyrophosphate, 2 mM dithiothreitol (DTT), 5 mM
MgCl2, 10 units of pig heart
dihydrolipoyl dehydrogenase, 0.1% vol/vol Triton X-100, 0.5 mM
-ketoisovalerate, and BCKA dehydrogenase complex (1.0-2.0 mg
protein). All assays were performed at 30°C, and enzyme activity is
expressed as nanomoles of NADH formed per minute per milligram of
protein. The selection of the 30°C temperature was to maintain a
linear rate of enzyme activity over the time course of the reaction
(5-6 min).
-keto-[1-14C]isocaproate
(30). The
-keto-[1-14C]isocaproate
was prepared in this laboratory from
L-[l-14C]leucine
(Amersham) by incubating it with
L-amino-acid oxidase, as
described by Rudiger et al. (36). The complete assay mixture contained
(final volume 1 ml) 25 mM HEPES, 2 mM
NAD+, 0.5 mM CoASH, 0.5 mM
thiamine pyrophosphate, 0.20 mM
-keto-[l-14C]isocaproate
(2,500 dpm/nmol), 0.2 mM Na2-EDTA,
0.2% Brij58, 1 mM DTT, 2 mM
MgSO4, 1 mM
N-2-P-tosyl-L-lysine
chloromethyl ketone, 20 µg/ml leupeptin, and appropriate amounts of
BCKA dehydrogenase (0.5-1.5 mg of protein). All assays were done
in duplicate at 37°C, and the reaction was carried out for 15 min.
At the end of this period, the reactions were stopped with 5 N
H2SO4,
14CO2
was collected in hydroxide of Hyamine, and radioactivity was determined
by liquid scintillation spectrometry (30). Enzyme activity is expressed
as nanomoles of CO2 released per
minute per milligram of protein.
The activity state in both cardiac and skeletal muscles was studied by
determining BCKA dehydrogenase activity before and after treatment of
the extracted enzyme complex with a broad specificity phosphoprotein
phosphatase (25 mU of phosphatase/mg protein for 60 min at 37°C).
The phosphoprotein phosphatase was purified from rat liver, as
described previously (11). Protein concentration was determined by the
Bio-Rad (Richmond, CA) protein assay, with bovine serum albumin as the standard.
Analysis of rate of inactivation of BCKA dehydrogenase. BCKA dehydrogenase kinase (BCKAD kinase) complex was extracted from frozen cardiac (34) and skeletal (33) muscles. The rate of inactivation of BCKA dehydrogenase in the cardiac and skeletal muscles was determined as described previously (34). Briefly, the complete reaction mixture contained, in a final volume of 0.2 ml, 30 mM HEPES (pH 7.35), 1.5 mM MgCl2, 5 mM DTT, 0.1 mM EDTA, 0.05% wt/vol Triton X-100, 0.1 µM leupeptin, 10 µg/ml trypsin inhibitor, 0.5 mM ATP, and 0.10 mg of extracted BCKA dehydrogenase complex. Reactions were incubated at 30°C for 10 min. At various time intervals (0-10 min), aliquots (20 µl) were removed and transferred into the BCKA dehydrogenase assay mixture and dehydrogenase activity was measured as described previously (34).
RNA extraction and Northern blot analysis.
Total cellular RNA from freeze-clamped cardiac or skeletal muscle of
control and diabetic rats was extracted by RNAzol method (Tel-Test,
Friendswood, TX). RNA (20 µg for BCKA dehydrogenase and 25 µg for
BCKAD kinase) was fractionated on 0.9% wt/vol agarose gel containing
formaldehyde and was blotted onto a Nytran membrane (Schleider and
Schuell, Dassel, Germany). The membranes were hybridized as described
previously (25). Cloned cDNAs encoding the
E1
, E1
, and
E2 subunits of rat BCKA
dehydrogenase were kindly provided by Dr. Robert Harris, Indiana
University School of Medicine. Kinase cDNA was prepared using standard
RT-PCR protocol. The primer sequences (GenBank accession number U27456)
for kinase were as follows: CAGCCACCTTCTGAAAAGTG (sense primer
corresponding to nucleotides 162-181) and CCTCAGCTAACAGGGTTACC
(antisense primer corresponding to nucleotides 405-424).
32P-labeled cDNA probes were made
by random primer technique (8) ([32P]dCTP; Du Pont
NEN; Boston, MA; kit for radiolabeling DNA; Pharmacia Biotech,
Piscataway, NJ). Blots were subjected to autoradiography with Kodak
Biomax MS film at
70°C for 72 h. The intensity of bands was
quantified by densitometry using Image PC software (Scion, Frederick,
MD). RNA level for each sample was normalized to the abundance of
-actin RNA (cDNA clone; Clontech Laboratories, Palo Alto, CA), which
served as an internal control for minor variations in sample loading.
Western blot analysis.
BCKA dehydrogenase and BCKAD kinase were quantitatively precipitated by
the PEG method, as described previously (33, 34). Identical amounts of
proteins (100 µg), precipitated from the skeletal and cardiac muscles
of control and diabetic rats, were suspended in SDS buffer [4%
(wt/vol) SDS, 0.125 M Tris · HCl, pH 6.8, 20%
(vol/vol) glycerol, and 0.125% (wt/vol) DTT] and boiled for 90 s. Samples were subjected to SDS-10% PAGE in the system of Laemmli
(19). Resolved proteins were transferred onto nitrocellulose membranes
[Hybond enhanced chemiluminescence (ECL); Amersham, Arlington
Heights, IL] and subjected to immunoblot analysis. The membranes
were incubated with either polyclonal antibody (1:2,000) raised against
purified BCKA dehydrogenase complex or polyclonal antibody (1:500)
raised against purified BCKAD kinase. Both antibodies were raised in
rabbits by Pel Freez Biologicals (Rogers, AZ). The membranes were then
washed and incubated with a second antibody (peroxidase-conjugated goat
anti-rabbit IgG) 1:2,000 for BCKA dehydrogenase or 1:1,000 for BCKAD
kinase, as described previously (7, 34). Subunits of BCKA dehydrogenase
and BCKAD kinase were detected with the ECL Western blotting system
(Amersham). The intensity of bands was quantified by densitometry by
use of Image PC. Preliminary studies showed linearity of Western blot assays from 50-200 µg of protein for
E1
,
E1
, and
E2 subunits and 75-225 µg
of protein for BCKAD kinase. The correlation coefficients between the
amount of protein and ECL image intensity were 0.93, 0.97, and 0.95 for
E1
,
E1
, and
E2 subunits of BCKA dehydrogenase, respectively, and 0.97 for BCKAD kinase (all
P < 0.01).
Statistics. All data are presented as means ± SE. Student's t-test was used for statistical analysis of data, with the corresponding P values given in figure legends. Each measurement was based on studies in 4-8 animals.
| |
RESULTS |
|---|
|
|
|---|
Diabetic status. After 96 h of insulin withdrawal, the blood glucose concentration of streptozotocin-treated rats was 336 ± 16 mg/dl. The blood glucose concentration of control rats was 128 ± 3 mg/dl. After 8-10 days of insulin therapy, the diabetic rats fully regained the weight they had lost earlier after the streptozotocin injection. However, again during the period of insulin withdrawal, they sustained some weight loss (20 ± 1 g).
BCKA dehydrogenase activity.
The first step in our experiment was to compare the effect of diabetes
on BCKA dehydrogenase activity in the skeletal (gastrocnemius) and
cardiac muscles of the same animals. The results (means ± SE in
6-8 rats) showed that diabetes increased BCKA dehydrogenase activity by fourfold in the skeletal muscle (1.5 ± 0.2 vs. 6.1 ± 1.2 nmol × 102 · mg
protein
1 · min
1,
P < 0.01) but that it decreased this
activity by twofold in the cardiac muscle (740 ± 105 vs. 370 ± 24 nmol × 102 · mg
protein
1 · min
1,
P < 0.01). We used the gastrocnemius
muscle for our study because it contains both red and white fibers.
Furthermore, it has been commonly used for studies of BCKA
dehydrogenase activity because it is a validated representative of
skeletal muscles (18).
Effect of diabetes on protein and gene expressions of BCKA
dehydrogenase.
BCKA dehydrogenase is composed of three catalytic proteins, designated
as E1,
E2, and
E3. The
E1 component is further composed of
- (E1
) and
-(E1
) subunits. The
E1 and
E2 components are specific for
BCKA dehydrogenase, whereas E3 is
common to other dehydrogenases. Therefore, the present study
includes the effect of diabetes on the protein expression of
E1
,
E1
, and
E2 subunits in the two muscle tissues.
(over 2-fold) than for either
E1
or
E2. In contrast to the skeletal
muscle, diabetes had no significant effect on the amount of any subunit
of BCKA dehydrogenase in the cardiac muscle (Fig. 1).
|
or
E1
. In sharp contrast to the
skeletal muscle, the gene expression of the three subunits was not
altered in the cardiac muscle of diabetic rats.
|
Effect of diabetes on the activity state of BCKA dehydrogenase. The above studies eliminated inverse alterations in the protein expressions of BCKA dehydrogenase as the mechanism of the different effect of diabetes on its activity. We therefore investigated the effect of diabetes on the activity state of BCKA dehydrogenase in the cardiac and skeletal muscles. The result (means ± SE in 6-8 rats) showed that diabetes increased the activity state by fourfold in the skeletal muscle (1.1 ± 0.1% vs. 4.6 ± 0.8%, P < 0.01) while decreasing the activity state by twofold in the cardiac muscle (28.2 ± 2.7% vs. 13.6 ± 1.0%, P < 0.01).
Alterations in the rate of inactivation of BCKA dehydrogenase have usually been found to be responsible for changes in the activity state. This leads to the following question: does diabetes have an inverse effect on the rates of inactivation of BCKA dehydrogenase? To answer this question, the following experiment was performed. The rate of inactivation was studied by determining BCKA dehydrogenase activity as a function of time when ATP was added to the extracted enzyme complex (11, 31). The rate of inactivation was calculated as the first-order kinetic constant, k · min
1,
of semilog plots of residual BCKA dehydrogenase activity vs. time (Fig.
3). The rate of inactivation was
significantly decreased in the skeletal muscle (0.19 ± 0.02 vs.
0.07 ± 0.02, P < 0.05), whereas
it was significantly increased in the cardiac muscle of the diabetic
rats (0.88 ± 0.06 vs. 2.13 ± 0.26, P < 0.01).
|
Effect of diabetes on protein and gene expressions of BCKAD kinase.
The inactivation of BCKA dehydrogenase is catalyzed by a specific
kinase, which recently has been cloned (35). The enzyme phosphorylates
two serine residues of BCKA dehydrogenase, one of which is responsible
for the inactivation of the enzyme (44). To investigate whether the
above alterations in the rates of inactivation were due to
corresponding alterations in the amount of BCKAD kinase in the skeletal
and cardiac muscles of diabetic rats, we determined the protein
expression of the kinase in each tissue. Qualitative and quantitative
analysis of Western blots showed that diabetes greatly decreased (over
2-fold) the protein expression of kinase in the skeletal muscle (Fig.
4) but significantly increased the protein
expression of this enzyme in the cardiac muscle (Fig. 4).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
This is the first study that was designed to compare the effect of diabetes on BCKA dehydrogenase activity in the cardiac and skeletal (gastrocnemius) muscles. The results show that, in diabetes, there are inverse alterations of BCKA dehydrogenase activity in the cardiac and skeletal muscles, which correspond to similar alterations in the activity state of the enzyme in these muscles. The activity state was increased in the skeletal muscle by decreasing the amount of BCKAD kinase, whereas the activity state was decreased in the cardiac muscle by increasing the amount of BCKAD kinase. The mechanism of these protein alterations appeared to be translational or posttranslational (gene expression unchanged) in the skeletal muscle but pretranslational (gene expression increased) in the cardiac muscle. In a recent study (22), we found that diabetes decreased the amount of BCKAD kinase in rat liver without any effect on its gene expression. Therefore, among the tissues studied thus far, the cardiac muscle appears unique with its increases of protein and gene expressions of BCKAD kinase in response to diabetes.
In addition to a decrease in the protein mass of BCKAD kinase such as
the one described above, there are other ways that BCKA dehydrogenase
activity could be increased in the skeletal muscle. For example, Hagg
et al. (12) showed that shortly after the beginning of leg exercise,
oxidation of leucine was increased by twofold in human subjects. Van
Hall et al. (39) showed that this exercise increased the activity state
of BCKA dehydrogenase in leg muscles. Because
-ketoisocaproate (KIC)
is a potent inhibitor of BCKAD kinase (21), and its muscle
concentration is increased in exercise (37), Shimomura et al. (37)
proposed that KIC is responsible for the activation of muscle BCKA
dehydrogenase during exercise. KIC is a transamination product of
leucine, and the muscle concentration of leucine is shown to be
increased during exercise (37). However, Kasperek (17) did not find an
increase in muscle concentration of KIC during exercise, but he did
find a decrease in muscle concentration of ATP. Because mitochondrial depletion of ATP results in activation of BCKA dehydrogenase (31), Kasperek (17) proposed that the same occurs in exercise. Despite this
controversy, which probably reflects a methodological problem, it is
reasonable to assume that both KIC and ATP concentrations influence
BCKA dehydrogenase activity.
In addition to the kinase effects, our study showed another
distinguishing feature in the response between the cardiac and skeletal
muscles to diabetes. In the cardiac muscle, neither the gene expression
nor the protein mass of any subunits of BCKA dehydrogenase was
affected, whereas these expressions were all increased in the skeletal
muscle. However, the results did not show a precise correlation between
the increases in the gene and protein expressions of BCKA dehydrogenase
subunits. For example, the increase was greatest for the mRNA encoding
the E2 subunit, whereas the
greatest increase for protein mass was for the
E1
subunit. Recently, we found
that diabetes increases the protein and gene expressions of all BCKA
dehydrogenase subunits in rat liver (22). Therefore, among the tissues
studied thus far, the cardiac muscle appears unique in having a BCKA
dehydrogenase with molecular expressions unresponsive to the effect of diabetes.
BCKA dehydrogenase and BCKAD kinase are linked together as an enzyme complex in mitochondria. As we have discussed, diabetes has different effects on the protein mass of these enzymes in the skeletal muscle. This indicates that these alterations are not part of a general process affecting the mitochondria but are consequences of metabolic regulation.
In light of these findings, a relevant question is whether conditions
such as high-protein diet and endurance training, which, like diabetes,
increase BCKA dehydrogenase activity in the skeletal muscle (9, 23),
are accompanied by increases in the protein and gene expressions of the
enzyme subunits. Miller et al. (23) showed that a high-protein diet did
not affect the protein expression of
E1
or
E2 subunits in the skeletal
muscle. The protein expression of
E1
was not studied. Fujii et
al. (9) showed that endurance training also did not affect the protein
expression of the E2 subunit in
the skeletal muscle. The protein expressions of other subunits were not
studied. However, Fujii et al. found that endurance training increased
the protein expression of BCKAD kinase in the skeletal muscle without
any effect on the abundance of mRNA encoding this enzyme. This is
exactly what we found in diabetes, with the exception of increases in
the protein expressions of all subunits of BCKA dehydrogenase (Fig. 2).
Therefore, there are similarities, as well as dissimilarities, between
the effects of diabetes and endurance training on the BCKA
dehydrogenase complex in the skeletal muscle.
Among the tissues we studied (liver and skeletal and cardiac muscles), diabetes had the greatest effect on BCKA dehydrogenase activity in the skeletal muscle, a fourfold increase in the skeletal muscle vs. a 70% increase in the liver (22) and a twofold decrease in the cardiac muscle. We speculate that the metabolic signal for this dramatic increase in BCKA dehydrogenase activity in the skeletal muscle was probably the lowering of plasma insulin level because of insulin withdrawal in streptozotocin-treated animals. Our speculation is based on the following observations: 1) administration of insulin in humans or animals decreased leucine oxidation in a dose-dependent manner (1, 10), and 2) studies in the perfused rat hindquarter preparation, which has been used for studies of muscle metabolism, showed that addition of insulin decreases the rate of leucine oxidation (14). Because there has been no study of the effect of insulin on leucine oxidation either in perfused rat heart or in perfused rat liver, it is not yet possible to speculate whether the fall in plasma insulin level was also the signal for the alterations in BCKA dehydrogenase activity in these tissues. Previous studies have shown that factors regulating the activity of BCKA dehydrogenase complex in the liver may not be the same as those in the skeletal muscle, or vice versa. For example, Paul et al. (34) showed that clofibrate feeding reduces the activity of BCKAD kinase in the liver without affecting this activity in the skeletal muscle.
In addition to a decrease in plasma insulin level, other factors could be responsible for the increase in BCKA dehydrogenase activity in the skeletal muscle of diabetic rats. For example, in the skeletal muscle of diabetic rats, KIC concentration increases (15), and the mitochondrial concentration of ATP decreases (31). As discussed above, both of these factors could activate BCKA dehydrogenase. However, they could not account for the increases in the protein mass of the enzyme subunits observed in the skeletal muscle (Fig. 1).
Finally, the present results unravel a molecular mechanism of the body's defense against a serious metabolic consequence of diabetes. In uncontrolled diabetes there are substantial increases in blood and tissue concentrations of branched-chain amino acids (4, 42), which lead to increased production of BCKA (15). BCKA are neurotoxic, as evidenced in maple syrup urine disease (6). Therefore, an increase in BCKA dehydrogenase activity brought on by an increase in its protein expression together with a decrease in the protein expression of its associated kinase in the skeletal muscle could be considered a protective mechanism. In view of the general belief that the skeletal muscle is the major site for oxidation of branched-chain amino acids (38), a severalfold increase in its BCKA dehydrogenase activity is likely to play a major role in the increase of whole body oxidation of BCKA observed in patients with diabetes mellitus (16, 20, 24). However, our previous studies (29, 40, 41) have shown that, whenever there is an increase in BCKA dehydrogenase activity, there is also an increase in protein catabolism. Therefore, the increased dehydrogenase activity in uncontrolled diabetes is most likely an early sign of protein wasting in the skeletal muscle. Protein wasting would have become apparent if we had allowed a longer period of uncontrolled diabetes. In the same context, an increase in the protein expression of BCKAD kinase in the cardiac muscle may be a sign of protein sparing in this tissue during uncontrolled diabetes.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Robert H. Lane (University of Pittsburgh School of Medicine) for the design and supply of the kinase primers.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-15855.
Present address of Y. B. Lombardo: School of Biochemistry, Ciudad Universitaria, 3000 Santa Fe, Argentina; present address of H. S. Paul: Biomed Research Technologies, Wexford, PA 15090.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for correspondence and reprint requests: S. A. Adibi, UPMC Health System, 200 Lothrop St., MUH E-321, Pittsburgh, PA 15213 (E-mail: adibi{at}med1.dept-med.pitt.edu).
Received 16 February 1999; accepted in final form 2 June 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abumrad, N. N.,
L. S. Jefferson,
S. R. Rannels,
P. E. Williams,
A. D. Cherrington,
and
W. W. Lacy.
Role of insulin in the regulation of leucine kinetics in the conscious dog.
J. Clin. Invest.
70:
1031-1041,
1982.
2.
Adibi, S. A.
Metabolism of branched-chain amino acids in altered nutrition.
Metabolism
25:
1287-1302,
1976[Medline].
3.
Aftring, R. P.,
W. J. Miller,
and
M. G. Buse.
Effects of diabetes and starvation on skeletal muscle branched-chain
-keto acid dehydrogenase activity.
Am. J. Physiol.
254 (Endocrinol. Metab. 17):
E292-E300,
1988
4.
Brosnan, J. T.,
K.-C. Man,
D. E. Hall,
S. A. Colbourne,
and
M. E. Brosnan.
Interorgan metabolism of amino acids in streptozotocin-diabetic ketoacidotic rat.
Am. J. Physiol.
244 (Endocrinol. Metab. 7):
E151-E158,
1983
5.
Buxton, D. B.,
and
M. S. Olson.
Regulation of the branched chain
-keto acid and pyruvate dehydrogenases in the perfused rat heart.
J. Biol. Chem.
257:
15026-15029,
1982
6.
Chaung, D. T.,
and
V. E. Shih.
Disorders of branched chain amino acid and keto acid metabolisms.
In: The Metabolic and Molecular Basis of Inherited Disease, edited by C. R. Schriver,
A. L. Beaudet,
W. S. Sly,
and D. Valle. New York: McGraw-Hill, 1995, p. 1239-1277.
7.
Chicco, A. G.,
S. A. Adibi,
W.-Q. Liu,
S. M. Morris, Jr.,
and
H. S. Paul.
Regulation of gene expression of branched-chain keto acid dehydrogenase complex in primary cultured hepatocytes by dexamethasone and a cAMP analog.
J. Biol. Chem.
269:
19427-19434,
1994
8.
Feinberg, A. P.,
and
B. Vogelstein.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:
6-13,
1983[Medline].
9.
Fujii, H.,
Y. Shimomura,
T. Murakami,
N. Nakai,
T. Sato,
M. Suzuki,
and
R. A. Harris.
Branched-chain
-keto acid dehydrogenase kinase content in rat skeletal muscle is decreased by endurance training.
Biochem. Mol. Biol. Int.
44:
1211-1216,
1998[Medline].
10.
Fukagawa, N. K.,
K. L. Minaker,
J. W. Rowe,
M. N. Goodman,
D. E. Matthews,
D. M. Bier,
and
V. R. Young.
Insulin-mediated reduction of whole body protein breakdown. Dose-response effects on leucine metabolism in postabsorptive men.
J. Clin. Invest.
76:
2306-2311,
1985.
11.
Gillim, S. E.,
R. Paxton,
G. A. Cook,
and
R. A. Harris.
Activity state of the branched chain
-ketoacid dehydrogenase complex in heart, liver, and kidney of normal, fasted, diabetic, and protein-starved rats.
Biochem. Biophys. Res. Commun.
111:
74-81,
1983[Medline].
12.
Hagg, S. A.,
E. L. Morse,
and
S. A. Adibi.
Effect of exercise on rates of oxidation, turnover, and plasma clearance of leucine in human subjects.
Am. J. Physiol.
242 (Endocrinol. Metab. 5):
E407-E410,
1982
13.
Harris, R. A.,
R. Paxton,
and
A. A. DePaoli-Roach.
Inhibition of branched chain
-ketoacid dehydrogenase kinase activity by
-chloroisocaproate.
J. Biol. Chem.
257:
13915-13918,
1982
14.
Hutson, S. M.,
T. C. Cree,
and
A. E. Harper.
Regulation of leucine and
-ketoisocaproate metabolism in skeletal muscle.
J. Biol. Chem.
253:
8126-8133,
1978
15.
Hutson, S. M.,
and
A. E. Harper.
Blood and tissue branched-chain amino and
-keto acid concentrations: effect of diet, starvation, and disease.
Am. J. Clin. Nutr.
34:
173-183,
1981
16.
Kalhan, S. C.,
S. C. Denne,
D. M. Patel,
I. F. Nuamah,
and
S. M. Savin.
Leucine kinetics during a brief fast in diabetes in pregnancy.
Metabolism
43:
378-384,
1994[Medline].
17.
Kasperek, G. J.
Regulation of branched-chain 2-oxo acid dehydrogenase activity during exercise.
Am. J. Physiol.
256 (Endocrinol. Metab. 19):
E186-E190,
1989
18.
Kasperek, G. J.,
and
R. D. Snider.
Effect of exercise intensity and starvation on activation of branched-chain keto acid dehydrogenase by exercise.
Am. J. Physiol.
252 (Endocrinol. Metab. 15):
E33-E37,
1987
19.
Laemmli, U. K.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:
680-685,
1970[Medline].
20.
Larivière, F.,
D. B. Kupranycz,
J.-L. Chiasson,
and
L. J. Hoffer.
Plasma leucine kinetics and urinary nitrogen excretion in intensively treated diabetes mellitus.
Am. J. Physiol.
263 (Endocrinol. Metab. 26):
E173-E179,
1992
21.
Lau, K. S.,
H. R. Fantania,
and
P. J. Randle.
Regulation of the branched-chain 2-oxo acid dehydrogenase kinase reaction.
FEBS Lett.
144:
57-62,
1982[Medline].
22.
Lombardo, Y. B.,
M. Thamotharan,
S. Z. Bawani,
H. S. Paul,
and
S. A. Adibi.
Posttranscriptional alterations in protein masses of hepatic branched-chain keto acid dehydrogenase and its associated kinase in diabetes.
Proc. Assoc. Am. Physicians
110:
40-49,
1998[Medline].
23.
Miller, R. H.,
R. S. Eisenstein,
and
A. E. Harper.
Effects of dietary protein intake on branched-chain keto acid dehydrogenase activity of the rat.
J. Biol. Chem.
263:
3454-3461,
1988
24.
Nair, K. S.,
G. C. Ford,
K. Ekberg,
E. Fernqvist-Forbes,
and
J. Wahren.
Protein dynamics in whole body and in splanchnic and leg tissues in Type I diabetic patients.
J. Clin. Invest.
95:
2926-2937,
1995.
25.
Nebes, V. L.,
and
S. M. Morris, Jr.
Regulation of messenger ribonucleic acid levels for five urea cycle enzymes in cultured rat hepatocytes. Requirements for cyclic adenosine monophosphate, glucocorticoids, and ongoing protein synthesis.
Mol. Endocrinol.
2:
444-451,
1988[Abstract].
26.
Patston, P. A.,
J. Espinal,
and
P. J. Randle.
Effects of diet and of alloxan-diabetes on the activity of branched-chain 2-oxo acid dehydrogenase complex and of activator protein in rat tissues.
Biochem. J.
222:
711-719,
1984[Medline].
27.
Paul, H. S.,
and
S. A. Adibi.
Effect of carnitine on branched-chain amino acid oxidation by liver and skeletal muscle.
Am. J. Physiol.
234 (Endocrinol. Metab. Gastrointest. Physiol. 3):
E494-E499,
1978.
28.
Paul, H. S.,
and
S. A. Adibi.
Leucine oxidation in diabetes and starvation: effects of ketone bodies on branched-chain amino acid oxidation in vitro.
Metabolism
27:
185-200,
1978[Medline].
29.
Paul, H. S.,
and
S. A. Adibi.
Leucine oxidation and protein turnover in clofibrate-induced muscle protein degradation in rats.
J. Clin. Invest.
65:
1285-1293,
1980.
30.
Paul, H. S.,
and
S. A. Adibi.
Activation of hepatic branched chain
-keto acid dehydrogenase by a skeletal muscle factor.
J. Biol. Chem.
257:
12581-12588,
1982
31.
Paul, H. S.,
and
S. A. Adibi.
Role of ATP in the regulation of branched-chain
-keto acid dehydrogenase activity in liver and muscle mitochondria of fed, fasted, and diabetic rats.
J. Biol. Chem.
257:
4875-4881,
1982
32.
Paul, H. S.,
and
S. A. Adibi.
Regulation of branched chain amino acid catabolism.
In: Branched Chain Amino and Keto Acids in Health and Disease, edited by S. A. Adibi,
W. Fekl,
U. Langenbeck,
and P. Schauder. Basel: Karger, 1984, p. 182-219.
33.
Paul, H. S.,
and
S. A. Adibi.
Mechanism of increased conversion of branched-chain keto acid dehydrogenase from inactive to active form by a medium-chain fatty acid (octanoate) in skeletal muscle.
J. Biol. Chem.
267:
11208-11214,
1992
34.
Paul, H. S.,
W.-Q. Liu,
and
S. A. Adibi.
Alteration in gene expression of branched-chain keto acid dehydrogenase kinase but not in gene expression of its substrate in the liver of clofibrate-treated rats.
Biochem. J.
317:
411-417,
1996.
35.
Popov, K. M.,
Y. Zhao,
Y. Shimomura,
M. J. Kuntz,
and
R. A. Harris.
Branched-chain
-ketoacid dehydrogenase kinase.
J. Biol. Chem.
267:
13127-13130,
1992
36.
Rudiger, H. W.,
U. Langenbeck,
and
H. W. Goedde.
A simplified method for the preparation of 14C-labelled branched-chain-oxo acids.
Biochem. J.
126:
445-446,
1972.
37.
Shimomura, Y.,
H. Fujii,
M. Suzuki,
N. Fujisuka,
M. Naoi,
S. Sugiyama,
and
R. A. Harris.
Branched-chain 2-oxo acid dehydrogenase complex activation by tetanic contractions in rat skeletal muscle.
Biochim. Biophys. Acta
1157:
290-296,
1993[Medline].
38.
Suryawan, A.,
J. W. Hawes,
R. A. Harris,
Y. Shimomura,
A. E. Jenkins,
and
S. M. Hutson.
A molecular model of human branched-chain amino acid metabolism.
Am. J. Clin. Nutr.
68:
72-81,
1998[Abstract].
39.
Van Hall, G.,
D. A. MacLean,
B. Saltin,
and
A. J. M. Wagenmakers.
Mechanisms of activation of muscle branched-chain
-keto acid dehydrogenase during exercise in man.
J. Physiol. (Lond.)
494:
899-905,
1996[Medline].
40.
Vazquez, J. A.,
E. L. Morse,
and
S. A. Adibi.
Effect of dietary fat, carbohydrate, and protein on branched-chain amino acid catabolism during caloric restriction.
J. Clin. Invest.
76:
737-743,
1985.
41.
Vazquez, J. A.,
H. S. Paul,
and
S. A. Adibi.
Regulation of leucine catabolism by caloric sources. Role of glucose and lipid in nitrogen sparing during nitrogen deprivation.
J. Clin. Invest.
82:
1606-1613,
1988.
42.
Wahren, J.,
P. Felig,
and
L. Hagenfeldt.
Effect of protein ingestion on splanchnic and leg metabolism in normal man and in patients with diabetes mellitus.
J. Clin. Invest.
57:
987-999,
1976.
43.
Ware, A. G.,
and
E. P. Marbach.
Glucose in serum and cerebrospinal fluid by direct application of a glucose oxidase method.
Clin. Chem.
14:
548-554,
1968[Abstract].
44.
Zhao, Y.,
J. Hawes,
K. M. Popov,
J. Jaskiewicz,
Y. Shimomura,
D. W. Crabb,
and
R. A. Harris.
Site-directed mutagenesis of phosphorylation sites of the branched chain
-ketoacid dehydrogenase complex.
J. Biol. Chem.
269:
18583-18587,
1994
This article has been cited by other articles:
![]() |
X. Wang, J. Hu, and S. R. Price Inhibition of PI3-kinase signaling by glucocorticoids results in increased branched-chain amino acid degradation in renal epithelial cells Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1874 - C1879. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Serdikoff and S. A. Adibi Protein Expressions of Branched-Chain Keto Acid Dehydrogenase Subunits Are Selectively and Posttranscriptionally Altered in Liver and Skeletal Muscle of Starved Rats J. Nutr., June 1, 2001; 131(6): 1682 - 1686. [Abstract] [Full Text] |
||||
![]() |
R. A. Harris, R. Kobayashi, T. Murakami, and Y. Shimomura Regulation of Branched-Chain {{alpha}}-Keto Acid Dehydrogenase Kinase Expression in Rat Liver J. Nutr., March 1, 2001; 131(3): 841S - 845. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |