AJP - Endo Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 277: E668-E677, 1999;
0193-1849/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sivitz, W. I.
Right arrow Articles by Haynes, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sivitz, W. I.
Right arrow Articles by Haynes, W. G.
Vol. 277, Issue 4, E668-E677, October 1999

Sympathetic inhibition, leptin, and uncoupling protein subtype expression in normal fasting rats

W. I. Sivitz, B. D. Fink, D. A. Morgan, J. M. Fox, P. A. Donohoue, and W. G. Haynes

Departments of Internal Medicine and Pediatrics, Divisions of Adult and Pediatric Endocrinology and Adult Cardiovascular Disease, University of Iowa and the Iowa City Veterans Affairs Medical Center, Iowa City, Iowa 52246


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

To further investigate neural effects on leptin and uncoupling proteins (UCPs), we studied in vivo perturbations intended to block adrenergic input to peripheral tissues. We examined plasma leptin, leptin mRNA, and adipose and muscle UCP subtype mRNA in rats treated with alpha -methyl-p-tyrosine methyl ester (AMPT-ME), which inhibits catecholamine synthesis and 6-hydroxydopamine (6HDA), which is toxic to catecholinergic nerve terminals but, unlike AMPT-ME, does not enter the central nervous system. Intraperitoneal AMPT-ME, 250 mg/kg, was administered at 1800 and 0700 the following day, and rats were killed at 1200-1400. All rats were fasted with free access to water during this time. Intraperitoneal AMPT-ME increased plasma leptin by 15-fold, increased interscapular brown adipose tissue (IBAT) and epididymal fat leptin mRNA by 2- to 2.5-fold, and also increased plasma insulin and glucose concentrations. Intraperitoneal AMPT-ME decreased IBAT UCP-3 mRNA to 40% of control, while it increased epididymal adipose UCP-3 mRNA approximately twofold. Intravenous AMPT-ME, 250 mg/kg, administered to conscious rats for 5 h decreased lumbar sympathetic nerve activity, increased plasma leptin (5.89 ± 1.43 compared with 2.75 ± 0.31 ng/ml in vehicle-treated rats, n = 7, P < 0.05), and decreased cardiac rate with no sustained change in blood pressure. Intraperitoneal 6HDA, 100 mg/kg, as a single dose at 1800, increased plasma leptin approximately twofold after 18-20 h, increased IBAT (but not epididymal fat) leptin mRNA by two- to threefold, and decreased IBAT UCP-3 mRNA to 30-40% of control. Neither AMPT-ME nor 6HDA significantly altered mRNA encoding gastrocnemius muscle UCP-3, IBAT UCP-1, or IBAT and epididymal UCP-2. In summary, AMPT-ME and 6HDA increased plasma leptin and upregulated leptin mRNA expression. AMPT-ME also resulted in complex tissue and subtype-specific modulation of adipose UCP mRNA. These data are consistent with interaction between leptin and sympathetic nerve activity (SNA) in regulation of fat cell energy utilization. However, the in vivo modulation of leptin and UCPs appears complex and, beyond a causal effect of SNA per se, may depend on concurrent changes in plasma insulin, glucose, and circulatory hemodynamics.

sympathetic activity; insulin sensitivity


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

ADRENERGIC NERVE ACTIVITY is well-known to regulate adipose tissue energy stores through lipolysis and activation of thermogenesis (14, 31). Recent evidence suggests that leptin may be an important modulator of adipose adrenergic activity and that adrenergic activation may, in turn, modulate leptin. We previously used direct nerve recording to demonstrate that intravenous leptin increases sympathetic nerve activity (SNA) in nerve fibers within the lumbar sympathetic chain and nerves innervating interscapular brown adipose tissue (IBAT), kidney, and adrenal glands (12). In addition, we and others have found that intracerebroventricular leptin increased SNA to IBAT (13) and lumbar nerves (10, 13).

Although adrenergic agonists, in particular those specific for the beta 3-adrenergic receptor, have been found to modulate leptin and UCP expression (4, 8, 20), these manipulations likely induce high concentrations of agonist in the area surrounding adrenergic receptors. Hence, it is not clear that these effects, at the receptor level, are physiological. An alternative way to address this issue in vivo is to administer adrenergic inhibitors that act proximal to these receptors to impair adrenergic input.

alpha -Methyl-p-tyrosine (AMPT) or its more soluble methyl ester (AMPT-ME) depletes tissue norepinephrine by inhibiting tyrosine hydroxylase, the initial and rate-limiting step in neuronal catecholamine synthesis (1, 34). Rayner et al. (25) found that AMPT-ME administered as a single dose of 300 mg/kg increased plasma leptin sixfold in lean (-/?) but not obese (ob/ob) mice. This could be attenuated by coadministration of a beta 3-adrenergic agonist, suggesting an important role for adrenergic input in regulating leptin production. However, Zimmermann et al. (35) found that administration of AMPT to human subjects in doses that reduced urinary norepinephrine metabolite excretion to approximately one-third of control did not change plasma leptin, raising doubt about the relationship between leptin production and sympathetic nerve activity.

Given these considerations, the current study was undertaken to determine whether in vivo global inhibition of sympathetic activity by AMPT-ME alters plasma leptin and tissue-specific leptin expression. Because AMPT-ME alters both central nervous system and peripheral catecholamine synthesis, we also questioned whether sympathetic inhibition by 6-hydroxydopamine (6HDA), which does not enter the central nervous system (32), had similar effects. 6HDA is a neurotoxin that induces chemical sympathectomy by destruction of catecholamine nerve terminals (7, 33).

One way in which sympathetic nerve activity may modulate adipose cell energy use may be through control of uncoupling protein (UCP) expression. Adrenergic stimulation, independent of cold exposure (16), specific activation of the IBAT beta 3-adrenergic receptor (19), and exogenously administered leptin (28) all increase IBAT UCP-1 expression. Therefore, in the current study, we also examined the effect of AMPT-ME and 6HDA on IBAT, epididymal fat, and gastrocnemius UCP mRNA expression. We quantified IBAT UCP-1 mRNA by Northern analysis and used ribonuclease protection to quantify the more recently identified UCP subtypes 2 and 3.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents and Supplies

Rats were purchased from Harlan Sprague Dawley (Indianapolis, IN). PCR primers were obtained through the DNA Core of our Diabetes and Endocrine Research Center. Antisense probe template DNA encoding nucleotides 38-142 of rat cyclophilin (pTRI-Cyclophilin-Rat) was purchased from Ambion (Austin, TX). The methyl ester of AMPT and 6HDA hydrochloride was purchased from Sigma (St. Louis, MO), solubilized in PBS, pH 5.3, and sterile filtered before injection. Other reagents, kits, and supplies were as specified or purchased from standard sources.

Animal Experiments

Animals were fed and maintained according to standard National Institutes of Health guidelines. Room temperature was maintained at 25°C. Three types of experiments were performed, all with normal male Sprague-Dawley rats treated with the following agents compared with vehicle controls: 1) intraperitoneal AMPT-ME; 2) intravenous AMPT-ME; and 3) intraperitoneal 6DHA.

Intraperitoneal AMPT-ME

Rats were fed ad libitum until 1800 on the day before time of death. At that point, rats received AMPT-ME (250 or 125 mg/kg) and controls received PBS, pH 5.3 (vehicle), as a bolus intraperitoneal injection followed by a second injection at 0700 the following day. Subsequently, rats were killed in alternating order (AMPT-ME and control) from 1200 to 1400. To avoid confounding effects of potential differences in food intake, all rats were maintained in the fasting state (free access to water) for the 18- to 20-h treatment period. Weights of the rats are shown in Table 1. Rats were anesthetized with methoxyflurane by inhalation. Blood was sampled by open-chest cardiac puncture, collected in heparinized tubes, and spun to obtain ~2 ml of plasma for analysis of plasma leptin, insulin, and glucose. IBAT, epididymal fat, and gastrocnemius muscle were then dissected free, frozen in liquid nitrogen, and stored at -70°C until used for preparation of RNA. Two sets of experiments were performed at different times for the higher and lower doses of AMPT-ME, and each was compared with separate vehicle controls.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Leptin, insulin, glucose, and weight data in rats treated with ip AMPT-ME or vehicle

Intravenous AMPT-ME

We measured lumbar sympathetic nerve activity, blood pressure, heart rate, and plasma parameters in rats treated with intravenous vehicle (405 ± 9 g, n = 7) or AMPT-ME (383 ± 15 g, n = 8, no significant difference from vehicle). Rats were briefly anesthetized with intraperitoneal methohexital sodium (40 mg/kg), and polyethylene catheters were inserted in the femoral artery and vein and a recording electrode was placed on the L2 and L3 roots of the lumbar plexus as Morgan et al. (22) have previously described. Lumbar SNA was continuously monitored and SNA was measured in units of volts per second by a resetting voltage integrator as Morgan et al. (21) have previously described. Two hours after rats regained consciousness, 250 mg/kg AMPT-ME or vehicle was administered as a 5-min, 0.5-ml continuous bolus into the femoral vein. For each rat, SNA at 5-min intervals was expressed as a percentage of the average of the -30- to 0-min values (V · s) for that animal (%baseline). Plasma leptin, insulin, and glucose were determined in arterial plasma obtained from 1 ml of whole blood sampled at baseline (time: 5 min relative to AMPT-ME or vehicle administration), 2, 3.5, and 5 h after AMPT-ME administration. Within 2 min after withdrawal of blood, the sample was centrifuged and cells were returned to the rat in saline added to make up the 1-ml vol removed. Rats were loosely restrained in a Plexiglas cylinder, which allowed forward and backward movement but prevented 180° rotation, and they were maintained in a Faraday cage to inhibit electrical interference during the experimental period. Blood pressure and pulse were continuously monitored with a pressure transducer in the femoral arterial line.

Intraperitoneal 6HDA

Rats were fed ad libitum until 1800 on the day before they were killed. At that point, rats received 6HDA (100 mg/kg) and controls received PBS, pH 5.3 (vehicle), as a single bolus intraperitoneal injection. Subsequently, rats were killed in alternating order (6HDA and control) from 1200 to 1400. To avoid confounding effects of potential differences in food intake, all rats were maintained in the fasting state (free access to water) for the 18- to 20-h treatment period. Weights of the rats are shown in Table 2. Rats were anesthetized, and blood and tissues were sampled as described in the intraperitoneal AMPT-ME experiments.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Leptin, insulin, glucose, and weight data in ip 6HDA- and vehicle-treated rats

RNA Quantification by Northern Blot Analysis

Total RNA was prepared with acid guanidine thiocyanate-phenol-chloroform extraction as described by Chomczynski and Sacchi (3). Five micrograms per lane were electrophoresed on a 1% agarose-formaldehyde denaturing gel (18) and transferred by capillary blotting to positively charged nylon membranes.

The full-length rat leptin cDNA was cloned and sequenced by PCR as we previously described (29). The sense and antisense primers, CAGGCTTCCAGTACTATTAGGT and TGCCAGTATGTGGTGGTTCACAAG (positions 142-163 and 604-627, respectively, GenBank accession no. M11814) were used to generate a 486-bp UCP-1 cDNA probe by standard PCR methodology (27). The cDNA fragments were labeled with 32P with a nick translation kit (Boehringer Mannheim, Indianapolis, IN), and unincorporated nucleotide was removed with Microcon-100 filter units (Amicon, Beverly, MA). Hybridization of cDNA was performed as described by the manufacturer of GeneScreen nylon membranes (NEN, Boston, MA). A 32P-labeled cyclophilin riboprobe was synthesized from pTRI-Cyclophilin-Rat with a MAXIscript in vitro transcription kit (Ambion), and the probe was hybridized as recommended by the manufacturer.

The blots were washed twice for 20 min each in 2× saline sodium citrate (SSC) and 0.1% SDS at room temperature and twice for 20 min each in 0.1× SSC and 0.1% SDS at 60°C followed by autoradiography at -60°C. Sequential hybridizations to the above probes were carried out by erasing blots by two exposures of 15 min each in 0.1% SDS at 95°C. mRNA levels were quantified by densitometry with a Hewlett-Packard ScanJet 4c scanner equipped with a transilluminator and image analysis software (SigmaGel, Jandel Scientific, San Rafael, CA). Each sample represented RNA from epididymal or brown adipose tissue of a single rat.

Specific mRNA levels were expressed in arbitrary units generated by normalizing band densities to the mean of vehicle-treated rats and defining this mean as 1.00. Because more than one blot was needed for analyzing the RNA samples for a given experimental perturbation, all blots were processed in the same fashion with equal numbers of control or test (AMPT-ME or 6HDA) samples. In addition, samples of pooled mRNA were included in duplicate or triplicate and densities were calculated relative to the mean of these samples before definition of the average vehicle control as 1.00.

The data are expressed relative to total RNA loaded per lane and to cyclophilin as a control marker. Cyclophilin mRNA itself, relative to total RNA loaded, was not significantly altered as a result of any of the animal perturbations studied. Finally, equal loading and integrity of the RNA was visually confirmed by the appearance of the ethidium bromide-stained gels.

RNA Quantification by Ribonuclease Protection Assay

Ribonuclease protection was carried out with the ribonuclease protection assay (RPA) II kit (Ambion). Protected fragments were separated on denaturing 5% acrylamide gels, which were dried and exposed to film in cassettes with intensifying screens at -60°C. Bands corresponding to protected fragments were quantified by densitometry and expressed in arbitrary units as described for Northern analysis. As in the Northern analysis, cyclophilin mRNA (control marker) calculated relative to total RNA was not significantly altered as a result of any of the perturbations studied. RNA integrity was verified before RPA by electrophoresis on agarose and ethidium bromide staining. Specific riboprobes for RPA were generated as follows.

UCP-2 mRNA. Sense and antisense primers CAGTTCTACACCAAGGGCTCAGAG and TCTGTCATGAGGTTGGCTT- TCAG were synthesized corresponding to positions 313-336 and 613-635, respectively, (nucleotide numbering in this text expressed relative to the ATG start site of translation) of the mouse UCP-2 cDNA (GenBank accession no. U94593) and used to amplify a cDNA fragment of the rat gene by reverse transcription PCR with rat epididymal fat total RNA as template. This generated a 323-bp product as predicted from the known mouse UCP-2 sequence. The PCR product was directly ligated into plasmid pCR3-Uni (Invitrogen, Carlsbad, CA). The product was sequenced with a Sequenase 2 kit (US Biochemical, Cleveland, OH) and found completely homologous to the subsequently reported rat gene (GenBank accession no. AF039033). As expected, based on its sequence, linearization with the restriction enzyme BstYI followed by transcription from the SP6 promoter produced a 203-nucleotide runoff transcript that protected a 123-nucleotide fragment of the mature rat UCP-2 mRNA.

UCP-3 mRNA. The sense PCR primer TACAGAGGGACTATGGATG corresponding to positions 463-481 of the rat UCP-3 sequence (GenBank accession no. U92069) and antisense primer CTCTAGCATTTAGGTGACACTATAGAACAGCTTCTCCTTGATGATG, whose 3' terminal 19 nucleotides corresponding to positions 591-609 of rat UCP-3 and adjacent 20 nucleotides to the SP6 promoter were used to generate a 174-bp PCR product by RT-PCR with rat IBAT RNA as template. This product was sequenced by the DNA core of our Diabetes and Endocrine Research Center, and the amplified region was found 100% homologous to the reported rat UCP-3 sequence. After purification with a Microcon-100 filter unit, the PCR product was used directly as template for run-off transcription generating a 150-nucleotide fragment predicted to protect 147 nucleotides of the mature rat UCP-3 mRNA.

Cyclophilin mRNA. pTRI-Cyclophilin-Rat was purchased in linearized form and used to generate 195-nucleotide run-off RNA transcripts from the SP6 promoter predicted to protect 103 nucleotides of mature cyclophilin mRNA.

Plasma Assays

Rat leptin was determined by RIA with a kit purchased from Linco (St. Louis, MO), which utilizes guinea pig polyclonal antibody to rat leptin. Interassay coefficient of variation in our hands is 9% at 1.77 ng/ml and 12% at 6.27 ng/ml over four assays, and the assay range is 0.5-50 ng/ml. Rat insulin was determined by RIA with a kit also purchased from Linco. Interassay coefficient of variation in our hands is 2% at 0.5 ng/ml, and the assay range is 0.1-10 ng/ml. Plasma glucose was measured with a YSI analyzer (Yellow Springs Instruments, Yellow Springs, OH).

Statistical Analyses

Groups were compared by the unpaired, two-tailed t-test or ANOVA as specified. In some cases, a one-tailed t-test was performed (as specified in the text) wherein the hypothesis was based on prior results.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Plasma leptin concentrations in the rats treated with intraperitoneal AMPT-ME, 250 mg/kg, were markedly increased compared with the vehicle-treated animals (Table 1). Plasma insulin and glucose concentrations were also increased in these rats (Table 1), suggesting an effect of this agent to decrease basal (postabsorptive) insulin sensitivity. These changes occurred even though, from the time of initial injection until time of death (during which time both AMPT-ME and vehicle-treated rats were maintained in the fasting state), the AMPT-ME-treated rats lost more body weight. In contrast to the higher dose of AMPT-ME, intraperitoneal administration of AMPT-ME, 125 mg/kg, did not alter plasma leptin, insulin, glucose, or body weight.

Consistent with the increase in plasma leptin concentration, leptin mRNA expression, normalized to cyclophilin, was ~2- to 2.5-fold greater in both epididymal and brown adipose tissue of the rats treated with the higher dose of intraperitoneal AMPT-ME compared with vehicle-treated rats (Fig. 1). Similar results (Fig. 1) were observed when leptin mRNA was normalized to total mRNA, although the data for IBAT leptin mRNA fell just short of significance (P = 0.06).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1.   Northern blot analysis of leptin and cyclophilin (cyclo) mRNA in alpha -methyl-p-tyrosine methyl ester (AMPT-ME)- and vehicle-treated rats. RNA was isolated from epididymal (Epi) adipose tissue (A) and interscapular brown adipose tissue (IBAT) (B). Representative blots (A and B, top) illustrate epididymal fat IBAT mRNA in 2 AMPT-ME-treated and 2 vehicle-treated rats and IBAT mRNA in same 4 animals. Quantitative (means ± SE) leptin mRNA data, normalized to total RNA and to cyclophilin mRNA as a control marker, are shown in A and B (bottom); n = 8 for each group. * P < 0.05, ** P < 0.025, *** P < 0.01 by 1-tailed, t-test (1-tailed hypothesis based on prior studies of plasma leptin).

Intraperitoneal 6HDA also increased plasma leptin (Table 2), although to a lesser extent than AMPT-ME. Moreover, 6HDA increased IBAT leptin mRNA by two- to threefold (Fig. 2). However, 6HDA did not significantly alter leptin mRNA in epididymal fat (Fig. 2). 6HDA, like AMPT-ME, resulted in greater weight loss in the treated rats compared with vehicle controls. 6HDA did not significantly change insulin or glucose concentrations.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 2.   Northern blot analysis of leptin and cyclophilin mRNA in 6-hydroxydopamine (6HDA) and vehicle-treated rats. RNA was isolated from epididymal adipose tissue (A) and IBAT (B). Representative blots (A and B, top) illustrate epididymal fat mRNA in 2 6HDA-treated and 2 vehicle-treated rats and IBAT mRNA in same 4 animals. Quantitative (means ± SE) leptin mRNA data, normalized to total RNA and to cyclophilin mRNA as a control marker, are shown in A and B (bottom); n = 8 for each group. * P < 0.0025, ** P < 0.01 by 1-tailed, t-test (1-tailed hypothesis based on prior studies of plasma leptin).

We also examined the effect of the higher dose of intraperitoneal AMPT-ME and the effect of 6HDA on adipose and gastrocnemius muscle UCP subtype mRNA expression. No significant differences were observed in IBAT UCP-1 mRNA between the AMPT-ME- or 6HDA-treated rats and their respective vehicle controls by Northern blot analysis (Fig. 3). As expected (16), UCP-1 expression was not detected in epididymal fat.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 3.   Northern blot analysis of IBAT uncoupling protein (UCP)-1 and cyclophilin mRNA in AMPT-ME- and vehicle-treated rats (A) and in 6HDA- and vehicle-treated rats (B). Representative blots in each panel illustrate UCP-1 and cyclophilin mRNA in 2 drug- and 2 vehicle-treated rats. Quantitative (means ± SE) UCP-1 mRNA data, normalized to total RNA and to cyclophilin mRNA as a control marker, are shown on right; n = 8 for each treatment group in A and B. No significant differences were detected.

Rat UCP-2 and UCP-3 were quantified by RPA and expressed relative to total RNA loaded as well as to cyclophilin mRNA as a control marker (Fig. 4). Both transcripts were detected in epididymal and brown adipose tissues although when assayed under identical conditions relative to cyclophilin, UCP-2 appeared more abundant in epididymal fat than IBAT, whereas the reverse was true for UCP-3 (Fig. 4). Quantitative changes in IBAT and epididymal fat UCP-2 and UCP-3 as a result of intraperitoneal AMPT-ME treatment are shown in Fig. 5. In IBAT, intraperitoneal AMPT-ME reduced UCP-3 mRNA, normalized to cyclophilin, to 40% of vehicle control. In sharp contrast, AMPT-ME increased UCP-3 mRNA levels more than twofold in epididymal fat. AMPT-ME did not significantly change IBAT or epididymal UCP-2 expression (Fig. 5), except for a modest reduction in IBAT UCP-2 noted only when the data were normalized to total RNA. AMPT-ME also had no significant effect on UCP-3 mRNA in gastrocnemius muscle either normalized to total RNA (1.49 ± 0.20, n = 8 for AMPT-ME-treated rats compared with 1.00 ± 0.21, n = 7 for vehicle) or cyclophilin (1.11 ± 0.17, n = 8 for AMPT-ME compared with 1.00 ± 0.33, n = 7 for vehicle). Only seven of the eight vehicle-treated rats could be analyzed for gastrocnemius UCP-3 transcripts because RNA from this tissue was not suitable for analysis in one of these rats.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 4.   Representative ribonuclease protection analyses of UCP-3, UCP-2, and cyclophilin mRNA in IBAT (A) and epididymal adipose tissue (B). Lanes 1 and 2 of (A and B) are protected mRNA fragments in adipose tissue from vehicle (lane 1) and AMPT-ME (lane 2)-treated rats. RNA from same 2 rats was loaded in lanes 1 and 2 on each radiogram. Lanes 3-5 in (A) (left panel) show digested probes (lane 3) and undigested UCP-3 (lane 4) and cyclophilin (lane 5) probes. Lanes 3-5 in A (right panel) show digested probes (lane 3) and undigested UCP-2 (lane 4) and cyclophilin (lane 5) probes. Undigested probes were loaded at 1-2% of counts used for probe hybridization.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5.   Quantitative (means ± SE) UCP-2 and UCP-3 mRNA data measured by ribonuclease protection in IBAT and epididymal adipose tissues of rats treated with ip AMPT-ME or vehicle (A and B) and with 6HDA or vehicle (C and D). UCP-3 mRNA levels (A and C) were normalized to control marker cyclophilin (Cy) or to total RNA (Tot). UCP-2 mRNA (B and D) were normalized in same manner. *P < 0.05, ** P < 0.01 by unpaired, 2-tailed, t-test.

To confirm the expected effect of AMPT-ME to decrease SNA, the agent was administered by intravenous injection to conscious rats and lumbar sympathetic activity was determined by direct nerve recording (Fig. 6). Means ± SE of SNA from 240 to 300 min were decreased in the AMPT-ME-treated rats compared with vehicle (84 ± 13% of baseline compared with 140 ± 23%, P < 0.05 by unpaired, two-tailed t-test). Mean baseline (0-30 min preinjection of AMPT-ME or vehicle) SNA in volts × second did not differ between the AMPT-ME and control groups (7.62 ± 1.12 and 8.26 ± 1.02, respectively). SNA initially (1st hour) increased in both the vehicle- and AMPT-ME-treated rats, an effect we attribute to manipulations including blood sampling, return of cells, and volume injection of the AMPT-ME or vehicle. By ~180 min, the curves diverge with a decrease in SNA in the AMPT-ME group. Notably, however, AMPT-ME had a more immediate effect to reduce SNA over the first 20 min followed by recovery to levels seen in the vehicle group. This transient effect is difficult to explain but may represent a direct sympatholytic action independent of the effect of the drug to inhibit tyrosine hydroxylase.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6.   Sympathetic nerve activity measured by resetting voltage integration (RVI; A), mean arterial pressure (MAP; B), and cardiac rate (C) at 5-min intervals from time -30 to 300 min relative to iv injection of AMPT-ME or vehicle. Data are means ± SE; n = 8 for AMPT-ME and n = 7 for vehicle-treated groups. Blood was sampled, and cells plus saline (volume equivalent to plasma removed) were returned over ~2-min time periods within 5-min intervals before (time 0) and 120 and 210 min after iv injection, and a final sample was obtained immediately after conclusion of 300-min experimental period.

The effects of AMPT-ME on mean arterial pressure and heart rate are also shown in Fig. 6. A transient early drop in mean arterial pressure corresponds to the aforementioned initial decrease in SNA in the AMPT-ME-treated rats. Cardiac rate was diminished in the AMPT-ME-treated rats, presumably the net effect of global sympatholysis in these animals. Finally, there are undulations in SNA, mean pressure, and rate corresponding to times of blood withdrawal and cell-volume replacement, apparently representing reflex neurovascular changes.

Leptin, insulin, and glucose were determined preinjection with AMPT-ME or vehicle and at the 120-, 210-, and 300-min time points postinjection (Fig. 7). Intravenous AMPT-ME increased plasma leptin (Fig. 7), which was evident by a significant drug (AMPT-ME or vehicle) × time interaction by two-way repeated-measures ANOVA, considering each time point as difference from baseline (time 0) leptin. There were no significant differences in glucose and insulin concentrations between the two groups.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 7.   Plasma leptin (A), insulin (B), and glucose (C) concentrations before (time 0) and 120, 210, and 300 min after iv injection of AMPT-ME or vehicle in same rats depicted in Fig. 6 (means ± SE). Two-way repeated-measures ANOVA of leptin time course data, as difference from baseline (time 0) leptin, revealed significant (P < 0.05) drug (AMPT-ME or vehicle) × time interaction.

Similar to AMPT-ME, 6HDA decreased IBAT UCP-3 mRNA to 30-40% of control (Fig. 5). However, unlike AMPT-ME, 6HDA did not significantly alter epididymal fat UCP-3 mRNA (Fig. 5). 6HDA did not change UCP-2 message in either IBAT or epididymal fat (Fig. 5) and did not affect UCP-3 mRNA in gastrocnemius muscle either normalized to total RNA (1.47 ± 0.33, n = 8, for 6HDA compared with 1.00 ± 0.20, n = 8, for vehicle) or cyclophilin (1.41 ± 0.37, n = 8, for 6HDA compared with 1.00 ± 0.21, n = 8, for vehicle).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Intraperitoneal AMPT-ME markedly increased plasma leptin (Table 1) accompanied by an increase in epididymal and brown adipose tissue steady-state leptin mRNA, suggesting that the increase in plasma leptin was, at least in part, mediated at the pretranslational level. Intravenous AMPT-ME also increased plasma leptin by 5 h after injection (Fig. 7). This effect was associated with a decrease in lumbar sympathetic nerve activity as determined by direct recording (Fig. 6). Moreover, others (5, 17) have reported that 4 h of AMPT-ME treatment (250 mg/kg as the methyl ester) decreases norepinephrine concentrations in several tissues including fat.

6HDA also increased plasma leptin. Unlike AMPT-ME, this agent does not cross the blood-brain barrier (32) and would not be expected to alter central nervous system centers, which might impact central neural output. This neurotoxin selectively destroys catecholamine nerve terminals by virtue of its uptake by the catecholamine high-affinity carrier (7, 33). 6HDA has been used widely as a means of inducing chemical sympathectomy, and its administration depletes catecholamines in several tissues but does not impair adrenal catecholamine release (24).

As observed for AMPT-ME, 6HDA also increased IBAT leptin mRNA. However, unlike AMPT-ME, 6HDA did not alter leptin message in epididymal (white) fat. Although speculative, we suggest the following explanation for this difference. The selective effect of 6HDA on IBAT leptin would be consistent with blockade of the rich adrenergic innervation of this tissue (11). Along this line of reasoning, the less selective effect of AMPT-ME could reflect the more generalized action of this agent. This would include poorly defined effects originating in the central nervous system and possibly effects on plasma insulin and/or glucose not seen with 6HDA. In any case, we suspect that the selective effect of 6HDA on IBAT leptin may account for the much smaller increase in plasma leptin after 6HDA than observed after AMPT-ME (Table 1).

Hence, our current findings, taken together with other studies, support the concept of a regulatory pathway involving secreted leptin, leptin-mediated SNA, and consequent negative modulation of leptin release through sympathetic activation of adipose adrenergic receptors. Other data consistent with this notion are as follows. We and others have shown that intravenous and intracerebroventricular leptin administration increases SNA measured by direct nerve recording in lumbar nerves (10, 12, 13) and nerve fibers to IBAT (12, 13). Furthermore, Collins et al. (5) reported that leptin administration increased sympathetic outflow as determined by norepinephrine turnover in IBAT. Finally, several groups reported that stimulation of the beta 3-adrenergic receptor by specific agonist treatment decreases plasma leptin (4, 8, 20). Although this action on adrenergic receptors may be pharmacological, our current data suggest that inhibition of catecholamine action proximal to the adrenergic receptor also alters leptin production consistent with a physiological action at the receptor level.

Our current results are consistent with those of Rayner et al. (25) who showed that intraperitoneal AMPT-ME, 300 mg/kg, markedly (6-fold) increased plasma leptin and elevated white adipose tissue leptin message in lean (-/?) but not obese (ob/ob) mice, an effect that was partially attenuated by administration of a beta 3-adrenergic agonist. On the other hand, Zimmermann et al. (35) reported that AMPT administration to humans in amounts sufficient to reduce the excretion of the norepinephrine metabolite 3-methoxy-4-hydroxyphenylglycol did not change plasma leptin. This discrepancy could be related to species difference or a difference in AMPT dose per unit body weight because our studies and those of Rayner et al. (25) involved a larger dose on a milligram per kilogram basis than administered in the human study. Moreover, we observed no effect of a lower dose of AMPT-ME on plasma leptin concentration.

The above discrepancies may also be rooted in the complexity of catecholamine inhibition. Although our data support an association of sympatholysis with substantial changes in plasma leptin and leptin message, we cannot conclude that these effects are mediated by sympathetic activity per se. In fact, our findings provide reason for caution regarding this issue. Although SNA did decline in intravenous AMPT-ME-treated rats (Fig. 6), the effects were complex and included altered circulatory hemodynamics. First, AMPT-ME (Fig. 6) induced a transient (first 20 min) drop in SNA and blood pressure. This effect is difficult to explain but may represent a direct sympatholytic effect rather than catecholamine synthesis inhibition. Second, there was an overall early increase in SNA in both AMPT-ME and vehicle groups, which was maximal at ~1 h postinjection, an effect likely secondary to the initial animal manipulations including drug or vehicle infusion, plasma sampling, and return of cells and volume. Finally, intravenous AMPT-ME reduced the cardiac rate although blood pressure was maintained throughout the 5-h infusion period.

In addition, intraperitoneal administration of both AMPT-ME and 6HDA likely induced a net fluid loss compared with vehicle-treated rats. Even though all rats were fasted after injection of these agents, the vehicle controls lost less weight, a difference which over the 18- to 20-h time frame is difficult to explain other than on the basis of altered fluid balance. Thus it is difficult to separate direct effects of sympathetic inhibition on leptin from potential effects secondary to altered circulatory hemodynamics.

Our results (Table 1) show that intraperitoneal AMPT-ME not only increased plasma leptin but also fasting plasma glucose and insulin. Although we cannot be sure of the mechanism, there are some logical possibilities. First, alpha -adrenergic blockade can have potent effects at the pancreatic islet level to increase insulin release (15, 23). However, this cannot fully explain the data because glucose was also elevated consistent with impaired basal (postabsorptive) insulin sensitivity. Possibly, this could result from reduced blood flow to muscle and consequent reduction in muscle glucose utilization. Hence, it is tempting to speculate that AMPT-ME induces a hyperleptinemic and insulin-resistant state similar to the clinical insulin-resistance syndrome. However, this relationship will require much more study to delineate precisely.

It could be argued that the AMPT-ME-induced increase in plasma leptin, observed in our current experiments, is secondary to the increase in insulin and/or the insulin-resistant state. In fact, we have previously shown that insulin acutely (hours) increases leptin mRNA and plasma leptin (30), the effect being apparently more prominent in rodents than humans. However, this explanation seems unlikely. First, when diabetic or normal rodents were given subcutaneous insulin in amounts raising plasma insulin considerably above our intraperitoneal AMPT-ME-treated rats, plasma leptin increased but only approximately two-fold above non-insulin-treated rats (30), far less in magnitude than observed in our AMPT-ME-treated rats (Table 1). Second, plasma leptin increased over the 5-h time period in our intravenous AMPT-ME-treated rats although no significant alteration in plasma insulin or glucose was evident (Fig. 7).

In addition to interacting with each other, there is evidence that circulating leptin and sympathetic nerve activity interact to regulate UCP expression. In IBAT, UCP activity, as determined by GDP binding, and UCP-1 expression are upregulated by adrenergic activity, an effect that occurs independent of environmental temperature (9, 16). In particular, beta 3-receptor activation (19) increases IBAT UCP-1 expression. Leptin also increases IBAT UCP-1 mRNA in rats at thermoneutrality (28) and upregulation of UCP-1 expression may explain leptin-induced thermogenesis in ob/ob mice (6). Given these considerations, a reasonable hypothesis would be that AMPT-ME and consequent effects on SNA might decrease UCP expression.

However, our findings (Figs. 3-5) proved more complex, suggesting tissue- and subtype-specific factors. Because adrenergic stimulation has previously been reported to increase IBAT UCP-1 expression, we were particularly surprised that neither intraperitoneal AMPT-ME nor 6HDA treatment decreased IBAT UCP-1 mRNA (Fig. 3). Possibly, the lack of a decrease in UCP-1 message, as hypothesized, may be related to the action of these agents to increase plasma leptin, thus offsetting what otherwise would have been the expected decrease in UCP-1 mRNA. In this regard, it should be noted that in the study by Rayner et al. (25), AMPT-ME did decrease IBAT UCP-1. These authors measured leptin and UCP-1 expression in mice 10 h after AMPT-ME administration, whereas we studied rats killed after 18-20 h.

Although no change was noted in IBAT UCP-1 expression, intraperitoneal AMPT-ME and 6HDA had significant effects on adipose UCP-3 mRNA. These depended markedly on the tissue examined. AMPT-ME decreased IBAT UCP-3 mRNA but increased UCP-3 transcripts in epididymal fat (Figs. 4 and 5). There were similar directional effects of AMPT-ME on IBAT and epididymal fat UCP-2 expression (Figs. 4 and 5); however, these effects were modest and, except for a decrease in UCP-2 mRNA normalized to total RNA, these changes were nonsignificant. Like AMPT-ME, 6HDA decreased IBAT UCP-3 mRNA. Unlike AMPT-ME, 6HDA did not alter epididymal fat UCP-3 mRNA. Interestingly, this more selective effect of 6HDA, as opposed to AMPT-ME, on IBAT UCP-3 is similar to what we observed for leptin message and may be related to the same factors (discussed previously). Despite these adipose effects of AMPT-ME and 6HDA, we observed no effect for either agent on gastrocnemius muscle UCP-3 message. UCP-3 appears to be the most abundant UCP subtype in skeletal muscle wherein it is strongly regulated by nutritional factors (2).

In summary, our findings provide novel information concerning the relationship between sympathetic nerve activity, leptin production, and UCP expression. We confirm the effect of high-dose AMPT-ME on plasma leptin and describe a tissue- and subtype-specific regulation of UCP-3 expression. In addition, we provide new data showing that 6HDA (which does not enter the central nervous system) has similar effects to increase plasma leptin, although its effect to increase leptin mRNA and decrease UCP-3 message appears selective for IBAT. Overall, our results support the concept of a role for sympathetic activity in regulating leptin and uncoupling activity. On the other hand, our hemodynamic data as well as our finding that AMPT increases insulin and glucose call for caution in interpreting the effects of sympathetic inhibition. These findings point to the complexity of sympathetic inhibition and caution that sympathetic traffic per se may not be solely responsible or have a direct causal relationship to leptin and UCP expression.

Perspectives

Adrenergic stimulation in the form of beta 3-adrenergic receptor activation is well-known to reduce leptin expression. Emerging data now suggest that decreased sympathetic activity is associated with increased leptin production. However, pharmacological sympatholysis is complex and we cannot assume that the increase in leptin is a direct result of impaired sympathetic traffic. Nonetheless, taken with other published reports (4, 5, 8, 10, 12, 13, 20), our data are consistent with the concept that sympathetic activity is important in the regulation of leptin and that a feedback-type mechanism may be involved.

Intraperitoneal AMPT-ME increased insulin and glucose as well as leptin. Given the well-recognized clinical association of hyperleptinemia, hyperinsulinemia, and hyperglycemia in the insulin-resistance syndrome, the current findings raise the possibility that altered sympathetic traffic may have a part in the pathogenesis of this syndrome. However, our experiments involved pharmacological global catecholamine blockade. The clinical syndrome of insulin resistance may involve a much more selective reduction in regional and receptor-specific adrenergic activity.

The AMPT-ME effects on UCP are complex and suggest subtype- and tissue-specific regulation. The question arises as to why UCP-3 should change in opposite fashion in the two types of adipose tissues studied. The question may reflect a fundamental physiological difference between these tissues. If UCP-3 has a role in IBAT diet-induced thermogenesis (which remains to be established) and if we consider that adrenergic activity is the major mediator of this type of thermogenesis (26), then it would not be surprising that impairment of SNA would decrease IBAT UCP-3 expression. On the other hand, subservient to food intake, white adipose tissue should store energy, in which case UCP activity would be counterproductive. In this sense, postfeeding adrenergic stimulation might teleologically be expected to downregulate white fat uncoupling activity. However, we also point out that although both AMPT-ME and 6HDA decreased IBAT UCP-3 mRNA, the effect of AMPT-ME to increase epididymal fat UCP-3 mRNA was not reproduced by 6HDA. Hence, this effect of AMPT-ME may be complex and, as discussed previously, may be related to more generalized in vivo physiological changes associated with administration of this agent.


    ACKNOWLEDGEMENTS

This study was supported by Veterans Affairs Medical Research Funds and National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-25295.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: W. Sivitz, Dept. of Internal Medicine, The Univ. of Iowa Hospitals and Clinics, 3E-17 VA, Iowa City, IA 52246 (E-mail: William-Sivitz{at}uiowa.edu).

Received 19 January 1999; accepted in final form 3 June 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Avakian, E., and S. Horvath. Starvation suppresses sympathoadrenal medullary response to cold exposure in rats. Am. J. Physiol. 241 (Endocrinol. Metab. 4): E316-E320, 1981[Abstract/Free Full Text].

2.   Boss, O., S. Samec, F. Kuhne, P. Bijlenga, F. Assimacopoulos-Jeannet, J. Seydoux, J. P. Giacobino, and P. Muzzin. Uncoupling protein-3 expression in rodent skeletal muscle is modulated by food intake but not by changes in environmental temperature. J. Biol. Chem. 273: 5-8, 1998[Abstract/Free Full Text].

3.   Chomczynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

4.   Collins, S., and R. S. Surwit. Pharmacologic manipulation of ob expression in a dietary model of obesity. J. Biol. Chem. 271: 9437-9440, 1996[Abstract/Free Full Text].

5.   Collins, S., C. M. Kuhn, A. E. Petro, A. G. Swick, B. A. Chrunyk, and R. S. Surwit. Role of leptin in fat regulation. Nature 380: 677, 1996[Medline].

6.   Commins, S. P., P. M. Watson, M. A. Padgett, A. Dudley, G. Argyropoulos, and T. W. Gettys. Induction of uncoupling protein expression in brown and white adipose tissue by leptin. Endocrinology 140: 292-300, 1999[Abstract/Free Full Text].

7.   DeLuigi, A., L. Terreni, T. M. Sironi, and M. G. DeSimoni. The sympathetic nervous system tonically inhibits peripheral interleukin-1beta and interleukin-6 induction by central lipopolysaccharide. Neuroscience 83: 1245-1250, 1998[Medline].

8.   Deng, C., M. Moinat, L. Curtis, A. Nadakal, F. Preitner, O. Boss, F. Assimacopoulos-Jeannet, J. Seydoux, and J. P. Giacobino. Effects of beta-adrenoceptor subtype stimulation on obese gene messenger ribonucleic acid and on leptin secretion in mouse brown adipocytes differentiated in culture. Endocrinology 138: 548-552, 1997[Abstract/Free Full Text].

9.   Desautels, M., and J. Himms-Hagen. Roles of noradrenaline and protein synthesis in the cold-induced increase in purine nucleotide bonding by brown adipose tissue mitochondria. Can. J. Biochem. 57: 968-976, 1979[Medline].

10.   Dunbar, J. C., Y. Hu, and H. Lu. Intracerebroventricular leptin increases lumbar and renal sympathetic nerve activity and blood pressure in normal rats. Diabetes 46: 2040-2043, 1997[Abstract].

11.   Flaim, K. E., J. M. Horowitz, and B. A. Horwitz. Functional and anatomical characteristics of the nerve-brown adipose interaction in the rat. Pflügers Arch. 365: 9-14, 1976[Medline].

12.   Haynes, W. G., D. A. Morgan, S. A. Walsh, A. L. Mark, and W. I. Sivitz. Receptor-mediated regional sympathetic nerve activation by leptin. J. Clin. Invest. 100: 270-278, 1997[Medline].

13.   Haynes, W. G., D. A. Morgan, S. A. Walsh, W. I. Sivitz, A. K. Johnson, and A. L. Mark. Sympathetic activation by leptin is mediated by the hypothalamus (Abstract). FASEB J. 12: A65, 1998.

14.   Himms-Hagen, J. Role of thermogenesis in the regulation of energy balance in relation to obesity. Can. J. Physiol. Pharmacol. 67: 394-401, 1988.

15.   Itoh, M., and J. Gerich. Adrenergic modulation of pancreatic somatostatin, insulin and glucagon secretion: evidence for differential sensitivity of islet A, B, and D cells. Metabolism 31: 715-720, 1982[Medline].

16.   Klaus, S., L. Casteilla, F. Bouillaud, and D. Ricquier. The uncoupling protein UCP: a membraneous mitochondrial ion carrier exclusively expressed in brown adipose tissue. Int. J. Biochem. 23: 791-801, 1991[Medline].

17.   Kuhn, C., R. Surwit, and M. Feinglos. Glipizide stimulates sympathetic outflow in diabetes-prone mice. Life Sci. 56: 661-666, 1994.

18.   Lerach, H., D. Diamond, J. M. Wozney, and H. Boedtker. RNA molecular weight determinations by gel electrophoresis under denaturing conditions, a critical reexamination. Biochemistry 16: 4743-4751, 1977[Medline].

19.   Li, H., M. Matheny, and P. J. Scarpace. beta 3-Adrenergic-mediated suppression of leptin gene expression in rats. Am. J. Physiol. 272 (Endocrinol. Metab. 35): E1031-E1036, 1997[Abstract/Free Full Text].

20.   Mantzoros, C. S., D. Qu, R. C. Frederich, V. S. Susulic, B. B. Lowell, E. Maratos-Flier, and J. S. Flier. Activation of beta(3) adrenergic receptors suppresses leptin expression and mediates a leptin-independent inhibition of food intake in mice. Diabetes 45: 909-914, 1996[Abstract].

21.   Morgan, D. A., E. A. Anderson, and A. L. Mark. Renal sympathetic nerve activity is increased in obese Zucker rats. Hypertension 25: 834-838, 1995[Abstract/Free Full Text].

22.   Morgan, D. A., T. W. Balon, B. H. Ginsberg, and A. L. Mark. Nonuniform regional sympathetic nerve responses to hyperinsulinemia in rats. Am. J. Physiol. 264 (Regulatory Integrative Comp. Physiol. 33): R423-R427, 1993[Abstract/Free Full Text].

23.   Narimiya, M., H. Yamada, I. Matsuba, Y. Ikeda, T. Tanese, and M. Abe. Adrenergic modulation of insulin and glucagon secretion from the isolated perfused rat pancreas. Endocrinol. Jpn. 28: 281-292, 1981[Medline].

24.   Radaelli, A., L. Micoli, S. Perlini, G. Bolla, I. Mori, G. Mancia, and U. Ferrari. Lack of autonomic contributions to tonic nitric oxide-mediated vasodilation in unanesthetized free-moving rats. J. Hypertens. 16: 55-61, 1998[Medline].

25.   Rayner, D. V., E. Simon, J. S. Duncan, and P. Trayhurn. Hyperleptinaemia in mice induced by administration of the tyrosine hydroxylase inhibitor alpha -methyl-p-tyrosine. FEBS Lett. 429: 395-398, 1998[Medline].

26.   Rothwell, N., and M. Stock. A role for brown adipose tissue in diet-induced thermogenesis. Nature 281: 31-35, 1979[Medline].

27.   Sambrook, J., J. M. Fritsch, and T. Maniatis. Molecular Cloning. Cold Springs Harbor, NY: Cold Springs Harbor Laboratory, 1989.

28.   Scarpace, P. J., M. Matheny, B. H. Pollock, and N. Tumer. Leptin increases uncoupling protein expression and energy expenditure. Am. J. Physiol. 273 (Endocrinol. Metab. 36): E226-E230, 1997[Abstract/Free Full Text].

29.   Sivitz, W. I., H. L. Bailey, and P. Donohoue. Rat adipose ob mRNA levels in states of altered circulating glucose and insulin. Biochem. Biophys. Res. Commun. 220: 520-525, 1996[Medline].

30.   Sivitz, W. I., S. Walsh, D. Morgan, P. Donohoue, W. Haynes, and R. L. Leibel. Plasma leptin in diabetic and insulin-treated diabetic and normal rats. Metabolism 47: 584-591, 1998[Medline].

31.   Stock, M., and N. Rothwell. Factors influencing brown fat and the capacity for diet-induced thermogenesis. Int. J. Obes. 9, Suppl. 2: 9-15, 1985.

32.   Thoenen, H., and J. P. Tranzer. The pharmacology of 6-hydroxydopamime. Annu. Rev. Pharmacol. Toxicol. 13: 169-180, 1973[Medline].

33.   Tranzer, J. P., and H. Thoenen. An electron microscopic study of selective, acute degeneration of sympathetic nerve terminals after administration of 6-hydroxydopamine. Experientia 24: 155-156, 1968[Medline].

34.   Yoshida, T., H. Nishioka, Y. Nakamura, and M. Kondo. Reduced norepinephrine turnover in mice with monosodium glutamate-induced obesity. Metabolism 33: 1060-1063, 1984[Medline].

35.   Zimmermann, R. C., L. Krahn, G. Klee, P. Delgado, S. J. Ory, and S. C. Lin. Inhibition of presynaptic catecholamine synthesis with alpha-methyl-para-tyrosine attenuates nocturnal melatonin secretion in humans. J. Clin. Endocrinol. Metab. 79: 1110-1114, 1994[Abstract].


Am J Physiol Endocrinol Metab 277(4):E668-E677
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Fukaya, A. Mizuno, H. Arai, K. Muto, T. Uebanso, K. Matsuo, H. Yamamoto, Y. Taketani, T. Doi, and E. Takeda
Mechanism of rapid-phase insulin response to elevation of portal glucose concentration
Am J Physiol Endocrinol Metab, August 1, 2007; 293(2): E515 - E522.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
P. Trayhurn and C. Bing
Appetite and energy balance signals from adipocytes
Phil Trans R Soc B, July 29, 2006; 361(1471): 1237 - 1249.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Y. Jeon, V. J. Harber, and R. D. Steadward
Leptin response to short-term fasting in sympathectomized men: role of the SNS
Am J Physiol Endocrinol Metab, March 1, 2003; 284(3): E634 - E640.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Hausberg, D. A. Morgan, J. L. Mitchell, W. I. Sivitz, A. L. Mark, and W. G. Haynes
Leptin Potentiates Thermogenic Sympathetic Responses to Hypothermia: A Receptor-Mediated Effect
Diabetes, August 1, 2002; 51(8): 2434 - 2440.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. L. Mitchell, D. A. Morgan, M. L.G. Correia, A. L. Mark, W. I. Sivitz, and W. G. Haynes
Does Leptin Stimulate Nitric Oxide to Oppose the Effects of Sympathetic Activation?
Hypertension, November 1, 2001; 38(5): 1081 - 1086.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sivitz, W. I.
Right arrow Articles by Haynes, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sivitz, W. I.
Right arrow Articles by Haynes, W. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online