|
|
||||||||
Endocrinologie de la Croissance et du Métabolisme, Station de Recherches Avicoles, Institut National de la Recherche Agronomique, 37380 Nouzilly, France
| |
ABSTRACT |
|---|
|
|
|---|
After insulin binding, insulin receptors (IR) phosphorylate the insulin receptor substrate 1 (IRS-1) on specific motifs and thereby initiate insulin action. The interaction between IR and IRS-1 and their expression were studied in vivo in two target tissues (muscle and liver) in chickens, a species that is insulin resistant. To induce extreme changes in plasma insulin levels, chickens were subjected to three different nutritional states (ad libitum fed, fasted for 48 h, and refed for 30 min after 48-h fast). Liver membrane IR number was significantly increased in fasted compared with fed chickens. This upregulation of IR number was concomitant with the an enhanced expression of IR mRNA as determined by reverse transcription-polymerase chain reaction. In leg muscle, IR mRNA was not altered by the nutritional state. Using specific antibodies directed toward human IR, anti-phosphotyrosines, or mouse IRS-1, we demonstrated that IR and IRS-1 are associated in vivo in liver and muscles. Tyrosine phosphorylation of liver IR and IRS-1 were significantly decreased by prolonged fasting and restored by 30-min refeeding. These alterations were not observed in muscle. Fasting increased IRS-1 mRNA expression in liver but not in muscle. These results are the first evidence showing that chicken liver and muscle express IRS-1. Therefore, the chicken insulin resistance is not accounted for by the lack of IRS-1. The differences observed for the regulation of IR and IRS-1 messengers and phosphorylation between liver and muscle in response to alterations of the nutritional state remain to be explained.
tyrosine kinase; insulin binding; insulin resistance; insulin receptor substrate 1
| |
INTRODUCTION |
|---|
|
|
|---|
INSULIN initiates its metabolic and growth-promoting effects through a specific transmembrane heterotetrameric tyrosine kinase receptor, the insulin receptor (IR) (6, 31). The IR tyrosine kinase phosphorylates at least one but more likely several intracellular substrates. In mammalian species, insulin receptor substrate 1 (IRS-1) is considered the major substrate for IR. IRS-1 contains motifs that, after tyrosine phosphorylation, are binding sites for proteins containing Src homology 2 (SH2) domains. Such proteins that interact with IRS-1 include phosphatidylinositol 3-kinase, Grb2, syp (SHPTP2), crk, and nck (5, 14, 18, 24, 25). Furthermore, the NH2 terminal of IRS-1 contains a region showing sequence similarity to pleckstrin, which is involved in protein-protein and phospholipid interactions. Finally, IRS-1 presents a phosphotyrosine binding domain that interacts with a phosphotyrosine located in the juxtamembrane NPEY motif of the IR (25). This plethora of protein-protein interaction motifs confers to IRS-1 the property of a multisite docking protein, making IRS-1 a key protein in transducing insulin metabolic and mitogenic effects. These interactions have been well dissected in vitro in mammalian cells (primary cultured cells and cell lines).
In the present report, we attempted to demonstrate the presence of IRS-1, its association with the IR, and its phosphorylation on tyrosine residues in two chicken target tissues (liver and muscles). Compared with mammals, this species presents a high plasma glucose level (2 g/l = 11 mM) despite the presence of hyperactive insulin and is largely resistant to exogenous insulin (20, 23). In the past, our group has showed that, in several tissues, chicken IR molecular structure and affinity are very similar to those described for mammalian IR. Furthermore, the tyrosine kinase activity of the chicken IR (21, 27) is altered by prolonged fasting or corticosterone treatment in liver but not in muscle (1, 22, 28).
To better understand the mechanisms that control insulin sensitivity in chicken tissues, we have recently cloned and sequenced the coding region of chicken IRS-1 gene (cIRS-1) (30). cIRS-1 presents a high identity with its human, rat, and mouse homologs (30). The most conserved regions were the pleckstrin homology domain, the IRS-1 homology 2 (IH2), the Shc and IRS-1 NPXY binding domains (SAIN), and the 12 tyrosine residues that are located in YXXM or YMXM motifs. All these data suggest that IRS-1 may play an important role in insulin action in chicken despite the weak hypoglycemic effect observed in response to exogenous insulin. In the present studies, IR and IRS-1 expressions and their tyrosine phosphorylation were studied in different and extreme nutritional conditions known to alter plasma insulin levels: prolonged fasting (48 h), refeeding for 30 min after 48-h fast, and ad libitum feeding. As a main conclusion, IRS-1 is present in chicken liver and muscle and interacts with the IR. In liver, but not in muscle, tyrosine phosphorylation of IRS-1 as well as that of IR is dependent on the nutritional state.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Chemicals.
Monocomponent porcine insulin was from Novo Industrie Pharmaceutique
(Paris, France). 125I was
purchased from Amersham France (Les Ulis, France). Bovine serum albumin
(BSA, fraction V radioimmunoassay grade), phenylmethylsulfonyl fluoride
(PMSF), leupeptin, aprotinin, and protein A-agarose were purchased from
Sigma Chemical (St. Louis, MO). Triton X-100 and sodium dodecyl sulfate
(SDS) were obtained from Bio-Rad Laboratories (Richmond, CA), and
Protogel was from National Diagnostic (Atlanta, GA). The
RNA Insta-Pure system kit for RNA extraction, avian myeloblastosis virus (AMV) reverse transcriptase, and Goldstar
Taq polymerase were obtained from
Eurogentec (Seraing, Belgium). Random hexamers and ribonuclease (RNase)
inhibitor rRNasin were purchased from Promega (Lyon, France), and
dexoynucleotide triphosphate (dNTP) was obtained from Oncor-Appligene
(Illkirch, France). Taq extender kit
was purchased from Stratagene (La Jolla, Ca). Anti-IRS-1 (
IRS-1) and
monoclonal anti-phosphotyrosine (
PY20) antibodies were obtained from
Transduction Laboratories (Lexington, KY). Anti-IR (B10) was a generous
gift from Dr. P. Gorden (National Institute of Diabetes and Digestive
and Kidney Diseases, Bethesda, MD). Primers used for reverse
transcription (RT)-polymerase chain reaction (PCR) were provided by
Genosys (Cambridge, UK).
Animals.
Male chickens (broiler type) were bred in a conventional floor pen, fed
ad libitum a balanced diet (3,100 kcal/kg metabolizable energy and 22%
protein), and exposed to a daily 14-h light period. At 9 wk of age,
animals were separated into three groups:
1) fasted for 48 h,
2) refed for 30 min after 48-h fast,
and 3) fed ad libitum. Liver and leg
muscles were quickly removed, frozen, powdered into liquid nitrogen,
and stored at
80°C.
Determination of plasma glucose and insulin levels. Plasma glucose levels were measured by the glucose oxidase method using an automated analyzer (Glucose Beckman Analyzer 2, Palo Alto, CA), and plasma insulin levels were determined by a radioimmunoassay with a guinea pig anti-porcine insulin antibody (Ab 27-6, generously provided by Dr. G. Rosselin, Hôpital Saint-Antoine, Paris) using chicken insulin as the standard.
Binding of insulin to liver membranes. Crude liver membranes were prepared by differential centrifugation as previously described (9). Insulin binding to liver membranes was measured in 0.15 ml of Krebs-Ringer phosphate buffer containing 1% BSA and 1 mg/ml bacitracin using 0.1 ng/ml 125I-porcine insulin and 0.4 mg/ml membrane protein (final concn) (13). Tracer binding was inhibited by increasing concentrations of unlabeled monocomponent porcine insulin (13-13,000 ng/ml). After 16 h of incubation at 4°C, the reaction was stopped by centrifugation at 12,000 g for 3 min. The resulting pellets were washed, and incorporated radioactivity was counted. Nonspecific binding was determined in the presence of an excess of unlabeled insulin (13.3 µg/ml) and was found to be 18-25% of total binding.
Immunoprecipitation.
Powdered tissues (1 g) were homogenized on ice with an Ultraturax
homogenizer in buffer A containing 150 mM NaCl, 10 mM tris(hydroxymethyl)aminomethane (pH 7.4), 1 mM EDTA, 1 mM ethylene glycol-bis(
-aminoethyl
ether)-N,N,N',N'-tetraacetic acid, 1% Triton X-100, 0.5% NP-40, protease inhibitors (2 mM PMSF, 10 µg/ml leupeptin, and 10 µg/ml aprotinin), and
phosphatase inhibitors (100 mM sodium fluoride, 10 mM sodium
pyrophosphate, and 2 mM sodium orthovanadate). Homogenates were
centrifuged at 600 g for 20 min at
4°C, and supernatants were then ultracentrifuged for 45 min at
45,000 rpm. Supernatants were aliquoted, and protein concentrations
were determined using a Bio-Rad kit and stored at
70°C.
PY20) or IR
(B10).
PY20 and B10 were added to samples at a final dilution of
1:500 and 1:50, respectively, and incubation was carried at 4°C
during 16 h. The immune complexes were precipitated by the addition of
protein A-agarose beads for 1 h at 4°C as previously described (11, 29). After two sequential washes using diluted buffer A (1:2), the resulting pellets
were resuspended in Laemmli buffer containing 80 mM dithiothreitol.
After SDS-polyacrylamide gel electrophoresis (PAGE) and
electrotransfer, proteins containing phosphotyrosines and/or
IRS-1 were detected by sequential incubation with
PY20 or
IRS-1,
respectively, and horseradish peroxidase (HRP)-linked anti-mouse or
anti-rabbit
-globulin (Amersham). Membranes were washed, and
enhanced chemiluminescence (ECL) was performed (29, 30).
In some experiments, liver and muscle extracts (12 µg of protein)
were subjected to SDS-PAGE without previous immunoprecipitation. After
electrotransfer onto nitrocellulose membranes, blots were incubated
with
IRS-1 and subjected to HRP anti-mouse or -rabbit
-globulin.
Finally, bands were revealed by ECL. Band densities were estimated by
using the NIH Image software.
Determination of cIRS-1 expression using RT-PCR. Total RNAs from liver and muscle of fed, refed, or fasted chickens were extracted using the RNA Insta-Pure system kit according to manufacturer's recommendations. Total RNAs were subjected to RT-PCR as previously described (30). Briefly, 1 µg of total RNA was reverse transcribed by AMV reverse transcriptase (15 U) in the presence of random hexamers (1 µg/µl). RT was carried out in the presence of MgCl2 (25 mM), dNTP mixture (2 mM) and rRNasin ribonuclease inhibitor. The RT reaction was assessed at 42°C for 60 min followed by an incubation at 95°C for 5 min. RT products were then subjected to PCR in standard conditions in the presence of two pairs of primers. The first pair of primers was specific to cIRS-1: sense, 5'-GCCCGGCCCACGAGGCTG-3' (bases 2630-2648) and antisense, 3'-GTACGCTTGTCCGTAACG-5' (bases 3120-3102) flanking a 490-bp region. The second pair of primers was specific to chicken IR tyrosine kinase domain cDNA (19): sense, TTGGGATGGGTTTATGAGGG and antisense, TAATAGTCGGTTTCATATAGAT flanking a 470-bp region. As an internal control of RT and PCR, we have used an amplification of 18S RNA using two primers flanking a 515-bp fragment (sense, 5'-CTGCCCTATCAACTTTCG-3' and antisense, 5'-CATTATTCCTAGCTGCGG-3').
Briefly, 2 µl of RT products were amplified by PCR in a final volume of 50 µl containing 5 µl of Taq 10× buffer, 3 µl of MgCl2 (1.5 mM final concn), 2 µl of dNTP (10 mM), 1 µl of sense and antisense primers, and 1 U of Goldstar Taq polymerase. Forty cycles were performed, each cycle consisting of denaturation (94°C, 1 min), annealing (58°C, 1 min), and elongation (72°C, 1 min) except for the first cycle, in which denaturation was for 4 min, and the last cycle, in which the extension time was for 10 min. RT-PCR products were analyzed in an agarose gel (1.5%) stained with ethidium bromide (1 mg/ml).Statistical analysis. Statistical analysis was performed using analysis of variance to detect significant intergroup differences (ad libitum fed, fasted for 48 h, and refed for 30 min after fast period). Data from multiple immunoblotting and RT-PCR experiments were expressed in arbitrary densitometry units normalized against the mean of ad libitum-fed control values within each experiment. Comparisons between ad libitum-fed (control) and fasted (48 h) chickens or between control and refed chickens (30 min after 48-h fast) were made using the Student's t-test. Data are expressed as means ± SE, and P < 0.05 was considered statistically significant.
| |
RESULTS |
|---|
|
|
|---|
Glucose and insulin plasma levels. Insulin and glucose plasma levels were determined in the different nutritional conditions: ad libitum fed, fasted for 48 h, and refed for 30 min after 48-h fast (Table 1). Fasting reduced plasma insulin levels (P < 0.05) compared with fed or refed states (Table 1), whereas plasma glucose levels were not significantly affected by the nutritional state (Table 1).
|
Insulin binding to chicken liver membranes. Insulin binding to crude liver membranes was measured in the various nutritional states. As previously shown (1), such direct measurement cannot be performed with muscle membranes, since, in this tissue, the proportion of nonspecific binding is too high. Liver membranes were incubated in the presence of 125I-porcine insulin and increasing concentrations of unlabeled insulin. Specific tracer insulin binding (B0), as a percentage of total radioactivity (T) added, was significantly increased in fasted chickens (B0 / T = 15.2 ± 0.7%, mean ± SE, n = 4) compared with fed chickens (B0 / T = 10.3 ± 0.7%, P < 0.05; Fig. 1, inset). Specific insulin binding level in refed chicken liver was intermediate. Figure 1 shows that the nutritional states did not affect IR affinity as estimated by the concentration of unlabeled insulin inhibiting tracer binding by 50%: 57 ± 3 (fed ad libitum), 62 ± 3 (fasted for 48 h), and 61 ± 3 (refed for 30 min after 48-h fast) ng insulin/ml, i.e., minor differences (P < 0.05).
|
Chicken liver and muscle express IRS-1.
Liver and muscle of fasted (48 h), fed (ad libitum), and refed (30- min
refed after 48-h fast) chickens were solubilized and subjected to
SDS-PAGE as described in MATERIALS AND
METHODS. After SDS-PAGE under reducing conditions and
electrotransfer onto nitrocellulose membranes, blots from liver and
muscle were probed with
IRS-1. After addition of secondary antibody
coupled to HRP (anti-mouse-HRP or anti-rabbit-HRP), bands were revealed
by ECL as previously described (11, 29). In the three nutritional
states,
IRS-1 revealed a band with a high molecular mass
(180-185 kDa) in both liver (Fig.
2A) and
muscle (Fig. 2B). The high identity
found between mouse and chicken IRS-1 coding regions (87%; Ref. 30) and the cross-reactivity observed with mouse
IRS-1 led us to conclude that this 180- to 185-kDa band is the chicken homolog of
IRS-1.
|
In vivo association of IRS-1 with IR in chicken liver and muscle.
Supernatants from solubilized liver materials were subjected to
immunoprecipitation using an anti-IR antibody (B10). After SDS-PAGE and
electrotransfer, nitrocellulose membranes were incubated in the
presence of
IRS-1. ECL revelation showed one band of high molecular
mass (180-185 kDa) corresponding to IRS-1 (Fig.
3A), which was present independent of the nutritional status. The
coimmunoprecipitation of IRS-1 and IR strongly indicates that, in vivo,
these two proteins are associated. The intensities of the bands were
measured using NIH Image software. The association of IR and
IRS-1 was slightly but consistently reduced in fasting state despite
the increase in IR number induced by fasting. This suggests that liver
IR and IRS-1 interaction is regulated by the nutritional state. IR and IRS-1 coimmunoprecipitation was also demonstrated in muscle from fed,
fasted, and refed chickens (Fig.
3B). However, in muscle, the
IRS-1-IR association does not appear to be qualitatively influenced by
nutritional states.
|
Regulation of IR and IRS-1 phosphorylation by nutritional state.
To determine the level of tyrosine phosphorylation of IR and IRS-1 in
response to nutritional states, supernatants from liver or muscle
lysates were immunoprecipitated with
PY20. After SDS-PAGE and
electrotransfer, nitrocellulose membranes were incubated with either
PY20 or
IRS-1. In liver, after immunoprecipitation and blotting
with
PY20, ECL detection revealed two major bands with apparent
molecular masses of 95 and 185 kDa, corresponding to the IR
-subunit
and to IRS-1, respectively (Fig. 4). As
shown in Fig. 4A, the level of
tyrosine phosphorylation of IR
-subunit and IRS-1 were reduced in
fasted state compared with fed and refed states. The level of tyrosine
phosphorylation was quantified using NIH Image software, and the mean
results are represented in Fig. 5,
A and
B. Results (arbitrary units) were
expressed as percentage of the level measured in fed state. Fasting
significantly reduced IRS-1 phosphorylation (by 21 ± 4%,
P < 0.05, Fig.
5B), which was restored after 30 min
of food intake (refed). Similarly, IR
-subunit phosphorylation was reduced after 48 h of fasting period (18 ± 2%,
P < 0.05) and restored after 30 min
of refeeding (Fig. 5A). The decrease
in IRS-1 phosphorylation in response to prolonged fasting was also
confirmed when
IRS-1 was used for immunoblotting after
PY20
immunoprecipitation (Fig. 4B). In
muscle, immunoprecipitation and immunoblotting using
PY20 showed
that IRS-1 and IR
-subunit were tyrosine phosphorylated (Fig.
6A). In
contrast to liver, the levels of muscle IRS-1 and IR
-subunit
tyrosine phosphorylations were not clearly decreased by prolonged
fasting, and this was confirmed by the quantification of band densities
(Fig. 6B).
|
|
|
Regulation of in vivo IRS-1 and IR mRNA expression by nutritional state. To determine the consequence of the nutritional status on IRS-1 and IR mRNA expression, total RNAs from chicken liver and muscle were subjected to RT-PCR using specific primers to amplify cIRS-1 and cIR cDNAs. RT and PCR were primed with random hexamers and two pairs of primers, respectively. For cIRS-1, specific primers were chosen flanking a 490-bp region as indicated in MATERIALS AND METHODS. For cIR, primers were selected in the tyrosine kinase domain and were specific to IR without overlapping with insulin-like growth factor I receptor cDNA as previously reported by Scavo et al. (19). They were flanking a fragment of 470 bp. As RNA expression control, we have subjected the same RT products to PCR using 18S RNA specific primers flanking a 515-bp region. After RT-PCR, ethidium bromide-stained agarose gel showed that IRS-1 and IR expressions were increased in liver after 48-h fast compared with the fed state (Fig. 7, A, lane 7 vs. 5, and B, lane 4 vs. 2), whereas the expression of 18S RNA was not influenced by the nutritional states in either liver or muscle (Fig. 7C). Gel density quantification using NIH Image software showed that liver cIRS-1 and cIR expression increased by about threefold in fasting chicken compared with fed chicken (Fig. 8). In muscle, IRS-1 expression was not significantly affected by the nutritional state, whereas IR expression was slightly increased in fasted state (Figs. 7 and 8). These data were confirmed by Northern blot analysis (data not shown).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
IRS-1 has been identified as a major substrate for the IR tyrosine kinase. IRS-1 gene has been cloned and sequenced in several species: mouse (2), rat (26), human (3), Xenopus (12), and chicken (30). It showed a high conservation during evolution (91% of identity for amino acid sequence between human and chicken IRS-1). The high conservation of cIRS-1 in chicken raised the question about its role in this species, which exhibits a large resistance to exogenous insulin and a high blood glucose level despite the presence of an hyperactive endogenous insulin (20, 23). The mechanisms of this insulin resistance are still unclear. To address this question, we first characterized cIRS-1 in vivo in two insulin target tissues, liver and muscle. We then studied the interaction between IRS-1 and IR, and their levels of phosphorylation and expression in vivo in different nutritional situations.
Three different nutritional states were chosen to exaggerate the differences in circulating insulin levels and reveal any modulation of IRS-1 expression and tyrosine phosphorylation: fasting for 48 h, refeeding for 30 min after 48-h fast, and ad libitum feeding (control state). The insulinemia was significantly decreased in fasted chickens; this decrease was accompanied by an upregulation of liver IR number. In response to 30-min refeeding, plasma insulin levels increased and liver IR number started to decrease, recovering from the upregulation state induced by prolonged fasting. In previous experiments in which the refeeding period was extended to 24 h, liver and kidney IR number (4, 22) decreased under the level observed in the fed state. As mentioned in the introduction, technical problems do not permit such determinations in muscle tissues. The degree of IR tyrosine phosphorylation was then determined in liver and muscle. In liver, IR phosphorylation was reduced by 48-h fast and restored by 30-min refeeding. The inhibitory effect of prolonged fasting observed for IR phosphorylation is in good agreement with previous studies showing that fasting reduced the intrinsic tyrosine kinase activity of solubilized and lectin-purified chicken liver IR (22). In contrast, in the present study, muscle IR phosphorylation was not altered by prolonged fasting. Again, this result is in good agreement with previous results showing that the tyrosine kinase activity of lectin purified muscle IR was unchanged after a 48-h fast (1). The absence of regulation of IR tyrosine kinase activity in response to prolonged fasting in muscle and its presence in liver has also been described for rat (8, 17). To further analyze the associations between IR and IRS-1 in liver and muscle of intact animals, coimmunoprecipitation experiments were performed after solubilization using various antibodies as mentioned in RESULTS. The coimmunoprecipitation of IR and IRS-1 in both tissues indicates the existence of a functional complex between IR and IRS-1 in intact animals as previously described in several cell lines (7, 10, 15, 16, 26). Futhermore, this association is regulated most likely in response to the ambient insulinemia: a slight increase in the association between IR and IRS-1 was suggested in the liver of refed chickens. Prolonged fasting also induced changes in the IR and IRS-1 mRNA levels in chicken liver. IR mRNA was overexpressed and thus should contribute to the development of the IR upregulation observed after fasting in this tissue as discussed earlier. Liver IRS-1 mRNA was also overexpressed in the fasted state without, however, clear changes in the protein level. Differences in the turnover of these two proteins may be involved. This discrepancy may also be explained by the techniques used to quantify IR and IRS-1: IR was quantified using 125I-insulin binding, whereas IRS-1 was estimated by Western blotting and densitometry. The latter techniques are less sensitive than the former. As observed for liver IR tyrosine phosphorylation, liver IRS-1 tyrosine phosphorylation was significantly decreased in fasted chickens and restored by 30-min refeeding. These data suggest that liver IRS-1 phosphorylation is coordinately regulated by the IR phosphorylation state, most likely through changes in circulating insulin levels. In contrast, muscle IRS-1 phosphorylation and, as discussed earlier, IR phosphorylation were not significantly affected by nutritional states. The origin and the physiological significance of the lack of any regulation of the phosphorylation state of both IR and IRS-1 in muscle despite large changes in plasma insulin concentrations are surprising and remain unexplained.
In conclusion, this is the first characterization of IRS-1 in chicken tissues. IRS-1 is present in liver and muscle; it associates with the IR and is phosphorylated on tyrosine residues. In liver, IRS-1 expression is increased and its tyrosine phosphorylation is decreased by prolonged fasting despite an increase in IR number. This change, which is most likely accounted for by a decrease in the IR tyrosine phosphorylation (and IR kinase activity), may lead to insulin resistance in the liver. Refeeding rapidly restores the phosphorylation of IR and IRS-1. To our knowledge, this is the first evidence showing that IRS-1 expression and phosphorylation are dependent on the nutritional state and, therefore, on the ambient circulating insulin levels in intact animals. In muscle, IRS-1 expression and tyrosine phosphorylation were not altered by the nutritional state, suggesting the presence of a tissue-specific regulation that remains unexplained. Although some peculiarities are likely to be present somewhere on the insulin signaling pathway to account for the natural resistance state found in chickens compared with mammals, the present studies demonstrate the presence of IRS-1 in chicken and suggest that IRS-1 also exerts a regulatory role in the control of metabolism and growth in this species. This role has now to be further characterized using different experimental models in which sensitivity is known to be altered.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Dr. Phillip Gorden (Diabetes Branch) for providing insulin receptor antibody (B10), Dr. G. Rosselin for providing guinea pig anti-porcine insulin antibody and L. Ruffier and Dr. M. Duclos for providing insulin tracer.
| |
FOOTNOTES |
|---|
This study was supported by the Association Française contre les Myopathies.
Address for reprint requests: M. Taouis, Endocrinologie de la Croissance et du Métabolisme, Station de Recherches Avicoles, INRA, 37380 Nouzilly, France.
Received 9 June 1997; accepted in final form 24 October 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adamo, M.,
J. Simon,
R. W. Rosebrough,
J. P. McMurtry,
N. C. Steele,
and
D. LeRoith.
Characterization of the chicken muscle insulin receptor.
Gen. Comp. Endocrinol.
68:
456-465,
1987[Medline].
2.
Araki, E.,
B. L. Haag,
and
C. R. Kahn.
Cloning of the mouse insulin receptor substrate-1 (IRS-1) gene and complete sequence of mouse IRS-1.
Biochim. Biophys. Acta
1221:
353-356,
1994[Medline].
3.
Araki, E.,
X. J. Sun,
B. L. Haag,
L. M. Chuang,
T. Yang-Feng,
M. F. White,
and
C. R. Kahn.
Human skeletal muscle insulin receptor substrate-1: characterization of the cDNA, gene and chromosomal localization.
Diabetes
42:
1041-1054,
1993[Abstract].
4.
Bisbis, S.,
M. Taouis,
M. Derouet,
B. Chevalier,
and
J. Simon.
Corticosterone-induced insulin resistance is not associated with alterations of insulin receptor number and kinase activity in chicken kidney.
Gen. Comp. Endocrinol.
96:
370-377,
1994[Medline].
5.
Case, R. D.,
E. Piccione,
G. Wolf,
A. M. Benett,
R. J. Lechleider,
B. G. Neel,
and
S. E. Shoelson.
SH-PTP2 syp SH2 domain binding specificity is defined by direct interactions with platelet-derived growth factor
-receptor, epidermal growth factor receptor, and insulin receptor substrate-1 derived phosphopeptides.
J. Biol. Chem.
269:
10467-10474,
1994
6.
Ebina, Y.,
L. Ellis,
K. Jarnagin,
M. Edery,
L. Graf,
E. Clauser,
H. K. Ou,
F. Masiarz,
Y. M. Kan,
J. D. Goldfine,
R. A. Roth,
and
W. J. Rutter.
The human insulin receptor cDNA: the structural basis for hormone-activated transmembrane signaling.
Cell
40:
747-758,
1985[Medline].
7.
Folli, F.,
M. J. Saad,
J. M. Backer,
and
C. R. Kahn.
Insulin stimulation of phosphatidylinositol 3 kinase activity and association with insulin receptor substrate 1 in liver and muscle of the intact rat.
J. Biol. Chem.
267:
22171-22177,
1992
8.
Freidenberg, G. R.,
H. H. Klein,
R. Cordera,
and
J. M. Olefsky.
Insulin receptor kinase activity in rat liver: regulation by fasting and high carbohydrate feeding.
J. Biol. Chem.
260:
12444-12453,
1985
9.
Havrankova, J.,
J. Roth,
and
M. Browstein.
Insulin receptors are widely distributed in the central nervous system of the rat.
Nature
272:
827-829,
1978[Medline].
10.
He, W.,
T. J. O'Neill,
and
T. A. Gustafson.
Distinct modes of interaction of SHC and insulin receptor substrate 1 with the insulin receptor NPEY region via non-SH2 domains.
J. Biol. Chem.
270:
23258-23262,
1995
11.
Levy-Toledano, R.,
L. H. P. Caro,
D. Accili,
and
S. I. Taylor.
Investigation of the mechanism of the dominant negative effect of mutations in the tyrosine kinase domain of the insulin receptor.
EMBO J.
13:
835-842,
1994[Medline].
12.
Liu, X. J.,
A. Sorisky,
L. Zhu,
and
A. Pawson.
Molecular cloning of an amphibian insulin receptor substrate-1 like cDNA and involvement of phosphatidylinositol 3 kinase in insulin induced Xenopus oocyte maturation.
Mol. Cell. Biol.
15:
3563-3570,
1995[Abstract].
13.
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr,
and
R. J. Randall.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:
265-275,
1951
14.
Myers, M. G.,
L. Wang,
X. J. Sun,
Y. Zhang,
L. Yenush,
J. Schlessinger,
J. H. Pierce,
and
M. F. White.
Role of IRS-1-Grb2 complexes in insulin signaling.
Mol. Cell. Biol.
14:
3577-3587,
1994
15.
Myers, M. G.,
Y. Zhang,
G. A. I. Aldaz,
T. Grammer,
E. M. Glasheen,
L. Yenush,
L. M. Wang,
X. J. Sun,
J. Blenis,
J. H. Pierce,
and
M. F. White.
YMXM motifs and signaling by an insulin receptor substrate 1 molecule without tyrosine phosphorylation sites.
Mol. Cell. Biol.
16:
4147-4155,
1996[Abstract].
16.
O'Neill, T. J.,
A. Craparo,
and
T. A. Gustafson.
Characterization of an interaction between insulin receptor substrate and the insulin receptor by using the two-hybrid system.
Mol. Cell. Biol.
14:
6433-6442,
1994
17.
Saad, M. J.,
E. Araki,
M. Milralpeix,
P. L. Rothenberg,
M. F. White,
and
C. R. Kahn.
Regulation of insulin receptor substrate-1 in liver and muscle of animal models of insulin resistance.
J. Clin. Invest.
90:
1839-1849,
1992.
18.
Sanchez-Margelet, V.,
J. D. Goldfine,
K. Truitt,
J. Imboden,
and
C. J. Sung.
Role of p85 subunit of phosphatidylinositol-3 kinase as an adaptor molecule linking the insulin receptor to insulin receptor substrate 1.
Mol. Endocrinol.
9:
435-442,
1995
19.
Scavo, L. M.,
J. Serrano,
J. Roth,
and
F. De Pablo.
Genes for the insulin receptor and the insulin-like growth factor-I receptor are expressed in the chicken embryo blastoderm and throughout organogenesis.
Biochem. Biophys. Res. Commun.
176:
1393-1401,
1991[Medline].
20.
Simon, J.
Chicken as a useful species for the comprehension of insulin action.
Crit. Rev. Poult. Biol.
2:
121-148,
1989.
21.
Simon, J.,
and
D. LeRoith.
Insulin receptors of chicken liver and brain. Characterization of
- and
-subunit properties.
Eur. J. Biochem.
158:
125-132,
1986[Medline].
22.
Simon, J.,
R. W. Rosebrough,
J. P. McMurtry,
N. C. Steele,
J. Roth,
M. Adamo,
and
D. LeRoith.
Fasting and refeeding alter the insulin receptor tyrosine kinase in chicken liver but fail to affect brain insulin receptors.
J. Biol. Chem.
261:
17081-17088,
1986
23.
Simon, J.,
and
M. Taouis.
The insulin receptor in chicken tissues.
In: Avian Endocrinology, edited by P. J. Sharp. Bristol, UK: Journal of Endocrinology, 1993, p. 177-188.
24.
Sugimoto, S.,
T. J. Wandless,
S. E. Shoelson,
B. G. Neel,
and
C. T. Walsh.
Activation of the SH2-containing protein tyrosine phosphatase, SH-PTP2, by phosphotyrosine containing peptides derived from insulin receptor substrate-1.
J. Biol. Chem.
269:
13614-13622,
1994
25.
Sun, X. J.,
M. Milralpeix,
M. G. Myers,
E. M. Glasheen,
J. M. Backer,
C. R. Kahn,
and
M. F. White.
Expression and function of IRS-1 in insulin signal transmission.
J. Biol. Chem.
267:
22662-22672,
1992
26.
Sun, X. J.,
J. P. Rothenberg,
C. R. Kahn,
J. M Backer,
E. Araki,
P. A. Wilden,
D. A. Cahill,
B. J. Goldstein,
and
M. F. White.
Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein.
Nature
352:
73-77,
1991[Medline].
27.
Taouis, M.,
M. Derouet,
J. P. Caffin,
A. Chavanieu,
and
J. Simon.
Insulin receptor and insulin sensitivity in a chicken hepatoma cell line.
Mol. Cell. Endocrinol.
96:
113-123,
1993[Medline].
28.
Taouis, M.,
M. Derouet,
B. Chevalier,
and
J. Simon.
Corticosterone effect on insulin receptor number and kinase activity in chicken muscle and liver.
Gen. Comp. Endocrinol.
89:
167-175,
1993[Medline].
29.
Taouis, M.,
R. Levy-Toledano,
P. Roach,
S. I. Taylor,
and
P. Gorden.
Structural basis by which a recessive mutation in the
-subunit of the insulin receptor affects insulin binding.
J. Biol. Chem.
269:
14912-14918,
1994
30.
Taouis, M.,
S. I. Taylor,
and
M. Reitman.
Cloning of the chicken insulin receptor substrate-1 gene.
Gene
178:
51-55,
1996[Medline].
31.
Ullrich, A.,
J. R. Bell,
E. Y Chen,
R. Herrera,
L. M. Petruzelli,
T. J. Dull,
A. Gray,
L. Coussens,
Y. C. Liao,
H. Tsubokowa,
A. Masur,
P. H. Seeburg,
C. Grunfeld,
O. M. Rosen,
and
J. Ramachandran.
Human insulin receptor and its relationship to the tyrosine kinase family of oncogenes.
Nature
313:
756-761,
1985[Medline].
This article has been cited by other articles:
![]() |
I. Seiliez, J.-C. Gabillard, S. Skiba-Cassy, D. Garcia-Serrana, J. Gutierrez, S. Kaushik, S. Panserat, and S. Tesseraud An in vivo and in vitro assessment of TOR signaling cascade in rainbow trout (Oncorhynchus mykiss) Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2008; 295(1): R329 - R335. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bigot, M. Taouis, and S. Tesseraud Refeeding and Insulin Regulate S6K1 Activity in Chicken Skeletal Muscles J. Nutr., February 1, 2003; 133(2): 369 - 373. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Fernandez, J. K. Kim, S. Yakar, J. Dupont, C. Hernandez-Sanchez, A. L. Castle, J. Filmore, G. I. Shulman, and D. Le Roith Functional inactivation of the IGF-I and insulin receptors in skeletal muscle causes type 2 diabetes Genes & Dev., August 1, 2001; 15(15): 1926 - 1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Fu, T. Noguchi, and H. Kato Vitamin A Deficiency Reduces Insulin-Like Growth Factor (IGF)-I Gene Expression and Increases IGF-I Receptor and Insulin Receptor Gene Expression in Tissues of Japanese Quail (Coturnix coturnix japonica) J. Nutr., April 1, 2001; 131(4): 1189 - 1194. [Abstract] [Full Text] |
||||
![]() |
M. A. Yaman, K. Kita, and J.-I. Okumura Various Macronutrient Intakes Additively Stimulate Protein Synthesis in Liver and Muscle of Food-Deprived Chicks J. Nutr., January 1, 2000; 130(1): 70 - 76. [Abstract] [Full Text] |
||||
![]() |
J. Dupont, J. Chen, M. Derouet, J. Simon, B. Leclercq, and M. Taouis Metabolic Differences between Genetically Lean and Fat Chickens Are Partly Attributed to the Alteration of Insulin Signaling in Liver J. Nutr., November 1, 1999; 129(11): 1937 - 1944. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |