AJP - Endo Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 274: E309-E316, 1998;
0193-1849/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dupont, J.
Right arrow Articles by Taouis, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dupont, J.
Right arrow Articles by Taouis, M.
Vol. 274, Issue 2, E309-E316, February 1998

Nutritional state regulates insulin receptor and IRS-1 phosphorylation and expression in chicken

Joëlle Dupont, Michel Derouet, Jean Simon, and Mohammed Taouis

Endocrinologie de la Croissance et du Métabolisme, Station de Recherches Avicoles, Institut National de la Recherche Agronomique, 37380 Nouzilly, France

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

After insulin binding, insulin receptors (IR) phosphorylate the insulin receptor substrate 1 (IRS-1) on specific motifs and thereby initiate insulin action. The interaction between IR and IRS-1 and their expression were studied in vivo in two target tissues (muscle and liver) in chickens, a species that is insulin resistant. To induce extreme changes in plasma insulin levels, chickens were subjected to three different nutritional states (ad libitum fed, fasted for 48 h, and refed for 30 min after 48-h fast). Liver membrane IR number was significantly increased in fasted compared with fed chickens. This upregulation of IR number was concomitant with the an enhanced expression of IR mRNA as determined by reverse transcription-polymerase chain reaction. In leg muscle, IR mRNA was not altered by the nutritional state. Using specific antibodies directed toward human IR, anti-phosphotyrosines, or mouse IRS-1, we demonstrated that IR and IRS-1 are associated in vivo in liver and muscles. Tyrosine phosphorylation of liver IR and IRS-1 were significantly decreased by prolonged fasting and restored by 30-min refeeding. These alterations were not observed in muscle. Fasting increased IRS-1 mRNA expression in liver but not in muscle. These results are the first evidence showing that chicken liver and muscle express IRS-1. Therefore, the chicken insulin resistance is not accounted for by the lack of IRS-1. The differences observed for the regulation of IR and IRS-1 messengers and phosphorylation between liver and muscle in response to alterations of the nutritional state remain to be explained.

tyrosine kinase; insulin binding; insulin resistance; insulin receptor substrate 1

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

INSULIN initiates its metabolic and growth-promoting effects through a specific transmembrane heterotetrameric tyrosine kinase receptor, the insulin receptor (IR) (6, 31). The IR tyrosine kinase phosphorylates at least one but more likely several intracellular substrates. In mammalian species, insulin receptor substrate 1 (IRS-1) is considered the major substrate for IR. IRS-1 contains motifs that, after tyrosine phosphorylation, are binding sites for proteins containing Src homology 2 (SH2) domains. Such proteins that interact with IRS-1 include phosphatidylinositol 3-kinase, Grb2, syp (SHPTP2), crk, and nck (5, 14, 18, 24, 25). Furthermore, the NH2 terminal of IRS-1 contains a region showing sequence similarity to pleckstrin, which is involved in protein-protein and phospholipid interactions. Finally, IRS-1 presents a phosphotyrosine binding domain that interacts with a phosphotyrosine located in the juxtamembrane NPEY motif of the IR (25). This plethora of protein-protein interaction motifs confers to IRS-1 the property of a multisite docking protein, making IRS-1 a key protein in transducing insulin metabolic and mitogenic effects. These interactions have been well dissected in vitro in mammalian cells (primary cultured cells and cell lines).

In the present report, we attempted to demonstrate the presence of IRS-1, its association with the IR, and its phosphorylation on tyrosine residues in two chicken target tissues (liver and muscles). Compared with mammals, this species presents a high plasma glucose level (2 g/l = 11 mM) despite the presence of hyperactive insulin and is largely resistant to exogenous insulin (20, 23). In the past, our group has showed that, in several tissues, chicken IR molecular structure and affinity are very similar to those described for mammalian IR. Furthermore, the tyrosine kinase activity of the chicken IR (21, 27) is altered by prolonged fasting or corticosterone treatment in liver but not in muscle (1, 22, 28).

To better understand the mechanisms that control insulin sensitivity in chicken tissues, we have recently cloned and sequenced the coding region of chicken IRS-1 gene (cIRS-1) (30). cIRS-1 presents a high identity with its human, rat, and mouse homologs (30). The most conserved regions were the pleckstrin homology domain, the IRS-1 homology 2 (IH2), the Shc and IRS-1 NPXY binding domains (SAIN), and the 12 tyrosine residues that are located in YXXM or YMXM motifs. All these data suggest that IRS-1 may play an important role in insulin action in chicken despite the weak hypoglycemic effect observed in response to exogenous insulin. In the present studies, IR and IRS-1 expressions and their tyrosine phosphorylation were studied in different and extreme nutritional conditions known to alter plasma insulin levels: prolonged fasting (48 h), refeeding for 30 min after 48-h fast, and ad libitum feeding. As a main conclusion, IRS-1 is present in chicken liver and muscle and interacts with the IR. In liver, but not in muscle, tyrosine phosphorylation of IRS-1 as well as that of IR is dependent on the nutritional state.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Chemicals. Monocomponent porcine insulin was from Novo Industrie Pharmaceutique (Paris, France). 125I was purchased from Amersham France (Les Ulis, France). Bovine serum albumin (BSA, fraction V radioimmunoassay grade), phenylmethylsulfonyl fluoride (PMSF), leupeptin, aprotinin, and protein A-agarose were purchased from Sigma Chemical (St. Louis, MO). Triton X-100 and sodium dodecyl sulfate (SDS) were obtained from Bio-Rad Laboratories (Richmond, CA), and Protogel was from National Diagnostic (Atlanta, GA). The RNA Insta-Pure system kit for RNA extraction, avian myeloblastosis virus (AMV) reverse transcriptase, and Goldstar Taq polymerase were obtained from Eurogentec (Seraing, Belgium). Random hexamers and ribonuclease (RNase) inhibitor rRNasin were purchased from Promega (Lyon, France), and dexoynucleotide triphosphate (dNTP) was obtained from Oncor-Appligene (Illkirch, France). Taq extender kit was purchased from Stratagene (La Jolla, Ca). Anti-IRS-1 (alpha IRS-1) and monoclonal anti-phosphotyrosine (alpha PY20) antibodies were obtained from Transduction Laboratories (Lexington, KY). Anti-IR (B10) was a generous gift from Dr. P. Gorden (National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD). Primers used for reverse transcription (RT)-polymerase chain reaction (PCR) were provided by Genosys (Cambridge, UK).

Animals. Male chickens (broiler type) were bred in a conventional floor pen, fed ad libitum a balanced diet (3,100 kcal/kg metabolizable energy and 22% protein), and exposed to a daily 14-h light period. At 9 wk of age, animals were separated into three groups: 1) fasted for 48 h, 2) refed for 30 min after 48-h fast, and 3) fed ad libitum. Liver and leg muscles were quickly removed, frozen, powdered into liquid nitrogen, and stored at -80°C.

Determination of plasma glucose and insulin levels. Plasma glucose levels were measured by the glucose oxidase method using an automated analyzer (Glucose Beckman Analyzer 2, Palo Alto, CA), and plasma insulin levels were determined by a radioimmunoassay with a guinea pig anti-porcine insulin antibody (Ab 27-6, generously provided by Dr. G. Rosselin, Hôpital Saint-Antoine, Paris) using chicken insulin as the standard.

Binding of insulin to liver membranes. Crude liver membranes were prepared by differential centrifugation as previously described (9). Insulin binding to liver membranes was measured in 0.15 ml of Krebs-Ringer phosphate buffer containing 1% BSA and 1 mg/ml bacitracin using 0.1 ng/ml 125I-porcine insulin and 0.4 mg/ml membrane protein (final concn) (13). Tracer binding was inhibited by increasing concentrations of unlabeled monocomponent porcine insulin (13-13,000 ng/ml). After 16 h of incubation at 4°C, the reaction was stopped by centrifugation at 12,000 g for 3 min. The resulting pellets were washed, and incorporated radioactivity was counted. Nonspecific binding was determined in the presence of an excess of unlabeled insulin (13.3 µg/ml) and was found to be 18-25% of total binding.

Immunoprecipitation. Powdered tissues (1 g) were homogenized on ice with an Ultraturax homogenizer in buffer A containing 150 mM NaCl, 10 mM tris(hydroxymethyl)aminomethane (pH 7.4), 1 mM EDTA, 1 mM ethylene glycol-bis(beta -aminoethyl ether)-N,N,N',N'-tetraacetic acid, 1% Triton X-100, 0.5% NP-40, protease inhibitors (2 mM PMSF, 10 µg/ml leupeptin, and 10 µg/ml aprotinin), and phosphatase inhibitors (100 mM sodium fluoride, 10 mM sodium pyrophosphate, and 2 mM sodium orthovanadate). Homogenates were centrifuged at 600 g for 20 min at 4°C, and supernatants were then ultracentrifuged for 45 min at 45,000 rpm. Supernatants were aliquoted, and protein concentrations were determined using a Bio-Rad kit and stored at -70°C.

Solubilized materials were subjected to immunoprecipitation using antibodies directed against either phosphotyrosines (alpha PY20) or IR (B10). alpha PY20 and B10 were added to samples at a final dilution of 1:500 and 1:50, respectively, and incubation was carried at 4°C during 16 h. The immune complexes were precipitated by the addition of protein A-agarose beads for 1 h at 4°C as previously described (11, 29). After two sequential washes using diluted buffer A (1:2), the resulting pellets were resuspended in Laemmli buffer containing 80 mM dithiothreitol. After SDS-polyacrylamide gel electrophoresis (PAGE) and electrotransfer, proteins containing phosphotyrosines and/or IRS-1 were detected by sequential incubation with alpha PY20 or alpha IRS-1, respectively, and horseradish peroxidase (HRP)-linked anti-mouse or anti-rabbit gamma -globulin (Amersham). Membranes were washed, and enhanced chemiluminescence (ECL) was performed (29, 30).

In some experiments, liver and muscle extracts (12 µg of protein) were subjected to SDS-PAGE without previous immunoprecipitation. After electrotransfer onto nitrocellulose membranes, blots were incubated with alpha IRS-1 and subjected to HRP anti-mouse or -rabbit gamma -globulin. Finally, bands were revealed by ECL. Band densities were estimated by using the NIH Image software.

Determination of cIRS-1 expression using RT-PCR. Total RNAs from liver and muscle of fed, refed, or fasted chickens were extracted using the RNA Insta-Pure system kit according to manufacturer's recommendations. Total RNAs were subjected to RT-PCR as previously described (30). Briefly, 1 µg of total RNA was reverse transcribed by AMV reverse transcriptase (15 U) in the presence of random hexamers (1 µg/µl). RT was carried out in the presence of MgCl2 (25 mM), dNTP mixture (2 mM) and rRNasin ribonuclease inhibitor. The RT reaction was assessed at 42°C for 60 min followed by an incubation at 95°C for 5 min. RT products were then subjected to PCR in standard conditions in the presence of two pairs of primers. The first pair of primers was specific to cIRS-1: sense, 5'-GCCCGGCCCACGAGGCTG-3' (bases 2630-2648) and antisense, 3'-GTACGCTTGTCCGTAACG-5' (bases 3120-3102) flanking a 490-bp region. The second pair of primers was specific to chicken IR tyrosine kinase domain cDNA (19): sense, TTGGGATGGGTTTATGAGGG and antisense, TAATAGTCGGTTTCATATAGAT flanking a 470-bp region. As an internal control of RT and PCR, we have used an amplification of 18S RNA using two primers flanking a 515-bp fragment (sense, 5'-CTGCCCTATCAACTTTCG-3' and antisense, 5'-CATTATTCCTAGCTGCGG-3').

Briefly, 2 µl of RT products were amplified by PCR in a final volume of 50 µl containing 5 µl of Taq 10× buffer, 3 µl of MgCl2 (1.5 mM final concn), 2 µl of dNTP (10 mM), 1 µl of sense and antisense primers, and 1 U of Goldstar Taq polymerase. Forty cycles were performed, each cycle consisting of denaturation (94°C, 1 min), annealing (58°C, 1 min), and elongation (72°C, 1 min) except for the first cycle, in which denaturation was for 4 min, and the last cycle, in which the extension time was for 10 min. RT-PCR products were analyzed in an agarose gel (1.5%) stained with ethidium bromide (1 mg/ml).

Statistical analysis. Statistical analysis was performed using analysis of variance to detect significant intergroup differences (ad libitum fed, fasted for 48 h, and refed for 30 min after fast period). Data from multiple immunoblotting and RT-PCR experiments were expressed in arbitrary densitometry units normalized against the mean of ad libitum-fed control values within each experiment. Comparisons between ad libitum-fed (control) and fasted (48 h) chickens or between control and refed chickens (30 min after 48-h fast) were made using the Student's t-test. Data are expressed as means ± SE, and P < 0.05 was considered statistically significant.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Glucose and insulin plasma levels. Insulin and glucose plasma levels were determined in the different nutritional conditions: ad libitum fed, fasted for 48 h, and refed for 30 min after 48-h fast (Table 1). Fasting reduced plasma insulin levels (P < 0.05) compared with fed or refed states (Table 1), whereas plasma glucose levels were not significantly affected by the nutritional state (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Effect of various nutritional states on plasma glucose and insulin levels in chickens

Insulin binding to chicken liver membranes. Insulin binding to crude liver membranes was measured in the various nutritional states. As previously shown (1), such direct measurement cannot be performed with muscle membranes, since, in this tissue, the proportion of nonspecific binding is too high. Liver membranes were incubated in the presence of 125I-porcine insulin and increasing concentrations of unlabeled insulin. Specific tracer insulin binding (B0), as a percentage of total radioactivity (T) added, was significantly increased in fasted chickens (B0 / T = 15.2 ± 0.7%, mean ± SE, n = 4) compared with fed chickens (B0 / T = 10.3 ± 0.7%, P < 0.05; Fig. 1, inset). Specific insulin binding level in refed chicken liver was intermediate. Figure 1 shows that the nutritional states did not affect IR affinity as estimated by the concentration of unlabeled insulin inhibiting tracer binding by 50%: 57 ± 3 (fed ad libitum), 62 ± 3 (fasted for 48 h), and 61 ± 3 (refed for 30 min after 48-h fast) ng insulin/ml, i.e., minor differences (P < 0.05).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1.   Competitive inhibition of 125I-labeled porcine insulin binding to chicken liver membranes in various nutritional states. Liver membranes were prepared from chickens that were either fasted for 48 h, ad libitum fed, or refed for 30 min after a 48-h fast. Crude membranes were incubated in presence of labeled insulin (0.1 ng/ml) for 16 h at 4°C in absence or presence of increasing concentrations of unlabeled porcine insulin. Percentage of maximal specific binding (B / B0) of 125I-insulin was determined and plotted against different unlabeled insulin concentrations. Inset: specific binding of labeled insulin (B) was expressed as percentage of total radioactivity added (T). Data are means ± SE; n = 4.

Chicken liver and muscle express IRS-1. Liver and muscle of fasted (48 h), fed (ad libitum), and refed (30- min refed after 48-h fast) chickens were solubilized and subjected to SDS-PAGE as described in MATERIALS AND METHODS. After SDS-PAGE under reducing conditions and electrotransfer onto nitrocellulose membranes, blots from liver and muscle were probed with alpha IRS-1. After addition of secondary antibody coupled to HRP (anti-mouse-HRP or anti-rabbit-HRP), bands were revealed by ECL as previously described (11, 29). In the three nutritional states, alpha IRS-1 revealed a band with a high molecular mass (180-185 kDa) in both liver (Fig. 2A) and muscle (Fig. 2B). The high identity found between mouse and chicken IRS-1 coding regions (87%; Ref. 30) and the cross-reactivity observed with mouse alpha IRS-1 led us to conclude that this 180- to 185-kDa band is the chicken homolog of IRS-1.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2.   Insulin receptor substrate 1 (IRS-1) expression in chicken liver and muscle. Livers (A) and muscles (B) from ad libitum-fed, fasted for 48 h, and refed (for 30 min after 48-h fast) chickens were isolated and solubilized as described in MATERIALS AND METHODS. Aliquots were resolved on 7.5% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) gel (12 µg of protein) and transferred to nitrocellulose filter by electroblotting. Blot was probed with an anti-IRS-1 antibody, and bands were revealed by enhanced chemiluminescence (ECL).

In vivo association of IRS-1 with IR in chicken liver and muscle. Supernatants from solubilized liver materials were subjected to immunoprecipitation using an anti-IR antibody (B10). After SDS-PAGE and electrotransfer, nitrocellulose membranes were incubated in the presence of alpha IRS-1. ECL revelation showed one band of high molecular mass (180-185 kDa) corresponding to IRS-1 (Fig. 3A), which was present independent of the nutritional status. The coimmunoprecipitation of IRS-1 and IR strongly indicates that, in vivo, these two proteins are associated. The intensities of the bands were measured using NIH Image software. The association of IR and IRS-1 was slightly but consistently reduced in fasting state despite the increase in IR number induced by fasting. This suggests that liver IR and IRS-1 interaction is regulated by the nutritional state. IR and IRS-1 coimmunoprecipitation was also demonstrated in muscle from fed, fasted, and refed chickens (Fig. 3B). However, in muscle, the IRS-1-IR association does not appear to be qualitatively influenced by nutritional states.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3.   Association of IRS-1 with insulin receptor (IR) in chicken liver and muscle. Livers (A) and muscles (B) from ad libitum-fed, fasted for 48 h, and refed chickens were solubilized. Solubilized samples were adjusted to 5 mg of protein, and IRs were immunoprecipitated (IP) with anti-IR antibody (B10). Immunoprecipitates were analyzed on SDS-PAGE (7.5%) followed by electroblotting. Blot was probed with either alpha IRS-1 or alpha PY20, and bands were detected by ECL. Results shown are representative of at least 2 independent experiments repeated twice.

Regulation of IR and IRS-1 phosphorylation by nutritional state. To determine the level of tyrosine phosphorylation of IR and IRS-1 in response to nutritional states, supernatants from liver or muscle lysates were immunoprecipitated with alpha PY20. After SDS-PAGE and electrotransfer, nitrocellulose membranes were incubated with either alpha PY20 or alpha IRS-1. In liver, after immunoprecipitation and blotting with alpha PY20, ECL detection revealed two major bands with apparent molecular masses of 95 and 185 kDa, corresponding to the IR beta -subunit and to IRS-1, respectively (Fig. 4). As shown in Fig. 4A, the level of tyrosine phosphorylation of IR beta -subunit and IRS-1 were reduced in fasted state compared with fed and refed states. The level of tyrosine phosphorylation was quantified using NIH Image software, and the mean results are represented in Fig. 5, A and B. Results (arbitrary units) were expressed as percentage of the level measured in fed state. Fasting significantly reduced IRS-1 phosphorylation (by 21 ± 4%, P < 0.05, Fig. 5B), which was restored after 30 min of food intake (refed). Similarly, IR beta -subunit phosphorylation was reduced after 48 h of fasting period (18 ± 2%, P < 0.05) and restored after 30 min of refeeding (Fig. 5A). The decrease in IRS-1 phosphorylation in response to prolonged fasting was also confirmed when alpha IRS-1 was used for immunoblotting after alpha PY20 immunoprecipitation (Fig. 4B). In muscle, immunoprecipitation and immunoblotting using alpha PY20 showed that IRS-1 and IR beta -subunit were tyrosine phosphorylated (Fig. 6A). In contrast to liver, the levels of muscle IRS-1 and IR beta -subunit tyrosine phosphorylations were not clearly decreased by prolonged fasting, and this was confirmed by the quantification of band densities (Fig. 6B).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4.   IRS-1 and IR beta -subunit tyrosine phosphorylation in chicken liver in various nutritional states. Livers from fed, refed (after 48 h of fast), and fasted chickens were extracted and solubilized. Solubilized proteins were equalized to 5 mg and immunoprecipitated using anti-phosphotyrosine antibody (alpha PY20). Immunoprecipitates were analyzed on SDS-PAGE (12%) followed by electroblotting. Blots were probed with either alpha PY20 (A) or an anti-IRS-1 antibody (alpha IRS-1; B), and bands were detected by ECL.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 5.   Quantification of liver IR and IRS-1 phosphorylation. Band densities from Fig. 4 were quantified by scanning densitometry and expressed as percent arbitrary units (nutritional state/fed state × 100). IR and IRS-1 phosphorylation levels are represented in A and B, respectively. Values are means ± SE; n = 6. * P < 0.05. 


View larger version (22K):
[in this window]
[in a new window]
 


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 6.   IRS-1 and IR beta -subunit tyrosine phosphorylation in chicken muscle in various nutritional states. Muscles extracted from fed, refed, and fasted chicken were solubilized. Solubilized proteins (5 mg) were immunoprecipitated using anti-phosphotyrosine antibody (alpha PY20). Immunoprecipitates were resolved on SDS-PAGE (12%) followed by electroblotting. Blot was probed with alpha PY20, and bands were detected by ECL (A). This result is representative of 6 and 2 independent experiments repeated twice for IRS-1 and IR beta -subunit phosphorylations, respectively (B).

Regulation of in vivo IRS-1 and IR mRNA expression by nutritional state. To determine the consequence of the nutritional status on IRS-1 and IR mRNA expression, total RNAs from chicken liver and muscle were subjected to RT-PCR using specific primers to amplify cIRS-1 and cIR cDNAs. RT and PCR were primed with random hexamers and two pairs of primers, respectively. For cIRS-1, specific primers were chosen flanking a 490-bp region as indicated in MATERIALS AND METHODS. For cIR, primers were selected in the tyrosine kinase domain and were specific to IR without overlapping with insulin-like growth factor I receptor cDNA as previously reported by Scavo et al. (19). They were flanking a fragment of 470 bp. As RNA expression control, we have subjected the same RT products to PCR using 18S RNA specific primers flanking a 515-bp region. After RT-PCR, ethidium bromide-stained agarose gel showed that IRS-1 and IR expressions were increased in liver after 48-h fast compared with the fed state (Fig. 7, A, lane 7 vs. 5, and B, lane 4 vs. 2), whereas the expression of 18S RNA was not influenced by the nutritional states in either liver or muscle (Fig. 7C). Gel density quantification using NIH Image software showed that liver cIRS-1 and cIR expression increased by about threefold in fasting chicken compared with fed chicken (Fig. 8). In muscle, IRS-1 expression was not significantly affected by the nutritional state, whereas IR expression was slightly increased in fasted state (Figs. 7 and 8). These data were confirmed by Northern blot analysis (data not shown).


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 7.   Expression of IRS-1 and IR in chicken liver and muscle. Total RNA from liver and muscle of fed, refed, and fasted chickens was prepared from ~100 mg of tissues as indicated in MATERIALS AND METHODS. A: primer, IRS-1 sense, 5'-GCCCGGCCCACGAGGCTG-3' (bases 2630-2648) and antisense, 3'-GTACGCTTGTCCGTAACG-5' (bases 3103-3120). B: IR sense primer, TTTGGATGGGTTTATGAGGG and antisense primer, TAATAGTCGGTTTCATATAGAT. C: 18S RNA sense primer, 5'-CTGCCCTATCAACTTTCG-3' and antisense primer, 5'CATTATTCCTAGCTGCGG-3'. In A, muscle and liver transcripts were deposited in lanes 2-4 and 5-7, respectively. In B and C, liver and muscle transcripts were deposited in lanes 2-4 and 5-7, respectively. Lanes 2 and 5, 3 and 6, and 4 and 7 represent nutritional states, respectively: ad libitum fed, refed for 30 min after 48-h fast, and fasted for 48 h. Lane 1 indicates migration of marker molecules (100 bp). Products of amplification were run on a 1.5% agarose gel and visualized by staining with ethidium bromide. Expected size of amplified producted is 490, 470, and 515 bp for IRS-1, IR, and 18S, respectively, and is indicated on right.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 8.   Relative levels of IRS-1 and IR mRNA in liver and muscle from fasted chickens compared with fed chickens. IRS-1 and IR mRNA in liver and muscle from fasted and fed chickens were determined by reverse transcription-polymerase chain reaction, and band densities were quantified using NIH software. Values shown represent relative IRS-1 and IR mRNA levels compared with fed state. In each case, level of IRS-1 and IR mRNA as adjusted to 1.0, and level in fasted state was normalized accordingly. Value for IRS-1 mRNA represents means of 4 separate assays, each done on RNA preparations prepared from different animals (n = 4). Value for IR mRNA represents mean of 2 separate assays.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

IRS-1 has been identified as a major substrate for the IR tyrosine kinase. IRS-1 gene has been cloned and sequenced in several species: mouse (2), rat (26), human (3), Xenopus (12), and chicken (30). It showed a high conservation during evolution (91% of identity for amino acid sequence between human and chicken IRS-1). The high conservation of cIRS-1 in chicken raised the question about its role in this species, which exhibits a large resistance to exogenous insulin and a high blood glucose level despite the presence of an hyperactive endogenous insulin (20, 23). The mechanisms of this insulin resistance are still unclear. To address this question, we first characterized cIRS-1 in vivo in two insulin target tissues, liver and muscle. We then studied the interaction between IRS-1 and IR, and their levels of phosphorylation and expression in vivo in different nutritional situations.

Three different nutritional states were chosen to exaggerate the differences in circulating insulin levels and reveal any modulation of IRS-1 expression and tyrosine phosphorylation: fasting for 48 h, refeeding for 30 min after 48-h fast, and ad libitum feeding (control state). The insulinemia was significantly decreased in fasted chickens; this decrease was accompanied by an upregulation of liver IR number. In response to 30-min refeeding, plasma insulin levels increased and liver IR number started to decrease, recovering from the upregulation state induced by prolonged fasting. In previous experiments in which the refeeding period was extended to 24 h, liver and kidney IR number (4, 22) decreased under the level observed in the fed state. As mentioned in the introduction, technical problems do not permit such determinations in muscle tissues. The degree of IR tyrosine phosphorylation was then determined in liver and muscle. In liver, IR phosphorylation was reduced by 48-h fast and restored by 30-min refeeding. The inhibitory effect of prolonged fasting observed for IR phosphorylation is in good agreement with previous studies showing that fasting reduced the intrinsic tyrosine kinase activity of solubilized and lectin-purified chicken liver IR (22). In contrast, in the present study, muscle IR phosphorylation was not altered by prolonged fasting. Again, this result is in good agreement with previous results showing that the tyrosine kinase activity of lectin purified muscle IR was unchanged after a 48-h fast (1). The absence of regulation of IR tyrosine kinase activity in response to prolonged fasting in muscle and its presence in liver has also been described for rat (8, 17). To further analyze the associations between IR and IRS-1 in liver and muscle of intact animals, coimmunoprecipitation experiments were performed after solubilization using various antibodies as mentioned in RESULTS. The coimmunoprecipitation of IR and IRS-1 in both tissues indicates the existence of a functional complex between IR and IRS-1 in intact animals as previously described in several cell lines (7, 10, 15, 16, 26). Futhermore, this association is regulated most likely in response to the ambient insulinemia: a slight increase in the association between IR and IRS-1 was suggested in the liver of refed chickens. Prolonged fasting also induced changes in the IR and IRS-1 mRNA levels in chicken liver. IR mRNA was overexpressed and thus should contribute to the development of the IR upregulation observed after fasting in this tissue as discussed earlier. Liver IRS-1 mRNA was also overexpressed in the fasted state without, however, clear changes in the protein level. Differences in the turnover of these two proteins may be involved. This discrepancy may also be explained by the techniques used to quantify IR and IRS-1: IR was quantified using 125I-insulin binding, whereas IRS-1 was estimated by Western blotting and densitometry. The latter techniques are less sensitive than the former. As observed for liver IR tyrosine phosphorylation, liver IRS-1 tyrosine phosphorylation was significantly decreased in fasted chickens and restored by 30-min refeeding. These data suggest that liver IRS-1 phosphorylation is coordinately regulated by the IR phosphorylation state, most likely through changes in circulating insulin levels. In contrast, muscle IRS-1 phosphorylation and, as discussed earlier, IR phosphorylation were not significantly affected by nutritional states. The origin and the physiological significance of the lack of any regulation of the phosphorylation state of both IR and IRS-1 in muscle despite large changes in plasma insulin concentrations are surprising and remain unexplained.

In conclusion, this is the first characterization of IRS-1 in chicken tissues. IRS-1 is present in liver and muscle; it associates with the IR and is phosphorylated on tyrosine residues. In liver, IRS-1 expression is increased and its tyrosine phosphorylation is decreased by prolonged fasting despite an increase in IR number. This change, which is most likely accounted for by a decrease in the IR tyrosine phosphorylation (and IR kinase activity), may lead to insulin resistance in the liver. Refeeding rapidly restores the phosphorylation of IR and IRS-1. To our knowledge, this is the first evidence showing that IRS-1 expression and phosphorylation are dependent on the nutritional state and, therefore, on the ambient circulating insulin levels in intact animals. In muscle, IRS-1 expression and tyrosine phosphorylation were not altered by the nutritional state, suggesting the presence of a tissue-specific regulation that remains unexplained. Although some peculiarities are likely to be present somewhere on the insulin signaling pathway to account for the natural resistance state found in chickens compared with mammals, the present studies demonstrate the presence of IRS-1 in chicken and suggest that IRS-1 also exerts a regulatory role in the control of metabolism and growth in this species. This role has now to be further characterized using different experimental models in which sensitivity is known to be altered.

    ACKNOWLEDGEMENTS

We are grateful to Dr. Phillip Gorden (Diabetes Branch) for providing insulin receptor antibody (B10), Dr. G. Rosselin for providing guinea pig anti-porcine insulin antibody and L. Ruffier and Dr. M. Duclos for providing insulin tracer.

    FOOTNOTES

This study was supported by the Association Française contre les Myopathies.

Address for reprint requests: M. Taouis, Endocrinologie de la Croissance et du Métabolisme, Station de Recherches Avicoles, INRA, 37380 Nouzilly, France.

Received 9 June 1997; accepted in final form 24 October 1997.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Adamo, M., J. Simon, R. W. Rosebrough, J. P. McMurtry, N. C. Steele, and D. LeRoith. Characterization of the chicken muscle insulin receptor. Gen. Comp. Endocrinol. 68: 456-465, 1987[Medline].

2.   Araki, E., B. L. Haag, and C. R. Kahn. Cloning of the mouse insulin receptor substrate-1 (IRS-1) gene and complete sequence of mouse IRS-1. Biochim. Biophys. Acta 1221: 353-356, 1994[Medline].

3.   Araki, E., X. J. Sun, B. L. Haag, L. M. Chuang, T. Yang-Feng, M. F. White, and C. R. Kahn. Human skeletal muscle insulin receptor substrate-1: characterization of the cDNA, gene and chromosomal localization. Diabetes 42: 1041-1054, 1993[Abstract].

4.   Bisbis, S., M. Taouis, M. Derouet, B. Chevalier, and J. Simon. Corticosterone-induced insulin resistance is not associated with alterations of insulin receptor number and kinase activity in chicken kidney. Gen. Comp. Endocrinol. 96: 370-377, 1994[Medline].

5.   Case, R. D., E. Piccione, G. Wolf, A. M. Benett, R. J. Lechleider, B. G. Neel, and S. E. Shoelson. SH-PTP2 syp SH2 domain binding specificity is defined by direct interactions with platelet-derived growth factor beta -receptor, epidermal growth factor receptor, and insulin receptor substrate-1 derived phosphopeptides. J. Biol. Chem. 269: 10467-10474, 1994[Abstract/Free Full Text].

6.   Ebina, Y., L. Ellis, K. Jarnagin, M. Edery, L. Graf, E. Clauser, H. K. Ou, F. Masiarz, Y. M. Kan, J. D. Goldfine, R. A. Roth, and W. J. Rutter. The human insulin receptor cDNA: the structural basis for hormone-activated transmembrane signaling. Cell 40: 747-758, 1985[Medline].

7.   Folli, F., M. J. Saad, J. M. Backer, and C. R. Kahn. Insulin stimulation of phosphatidylinositol 3 kinase activity and association with insulin receptor substrate 1 in liver and muscle of the intact rat. J. Biol. Chem. 267: 22171-22177, 1992[Abstract/Free Full Text].

8.   Freidenberg, G. R., H. H. Klein, R. Cordera, and J. M. Olefsky. Insulin receptor kinase activity in rat liver: regulation by fasting and high carbohydrate feeding. J. Biol. Chem. 260: 12444-12453, 1985[Abstract/Free Full Text].

9.   Havrankova, J., J. Roth, and M. Browstein. Insulin receptors are widely distributed in the central nervous system of the rat. Nature 272: 827-829, 1978[Medline].

10.   He, W., T. J. O'Neill, and T. A. Gustafson. Distinct modes of interaction of SHC and insulin receptor substrate 1 with the insulin receptor NPEY region via non-SH2 domains. J. Biol. Chem. 270: 23258-23262, 1995[Abstract/Free Full Text].

11.   Levy-Toledano, R., L. H. P. Caro, D. Accili, and S. I. Taylor. Investigation of the mechanism of the dominant negative effect of mutations in the tyrosine kinase domain of the insulin receptor. EMBO J. 13: 835-842, 1994[Medline].

12.   Liu, X. J., A. Sorisky, L. Zhu, and A. Pawson. Molecular cloning of an amphibian insulin receptor substrate-1 like cDNA and involvement of phosphatidylinositol 3 kinase in insulin induced Xenopus oocyte maturation. Mol. Cell. Biol. 15: 3563-3570, 1995[Abstract].

13.   Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193: 265-275, 1951[Free Full Text].

14.   Myers, M. G., L. Wang, X. J. Sun, Y. Zhang, L. Yenush, J. Schlessinger, J. H. Pierce, and M. F. White. Role of IRS-1-Grb2 complexes in insulin signaling. Mol. Cell. Biol. 14: 3577-3587, 1994[Abstract/Free Full Text].

15.   Myers, M. G., Y. Zhang, G. A. I. Aldaz, T. Grammer, E. M. Glasheen, L. Yenush, L. M. Wang, X. J. Sun, J. Blenis, J. H. Pierce, and M. F. White. YMXM motifs and signaling by an insulin receptor substrate 1 molecule without tyrosine phosphorylation sites. Mol. Cell. Biol. 16: 4147-4155, 1996[Abstract].

16.   O'Neill, T. J., A. Craparo, and T. A. Gustafson. Characterization of an interaction between insulin receptor substrate and the insulin receptor by using the two-hybrid system. Mol. Cell. Biol. 14: 6433-6442, 1994[Abstract/Free Full Text].

17.   Saad, M. J., E. Araki, M. Milralpeix, P. L. Rothenberg, M. F. White, and C. R. Kahn. Regulation of insulin receptor substrate-1 in liver and muscle of animal models of insulin resistance. J. Clin. Invest. 90: 1839-1849, 1992.

18.   Sanchez-Margelet, V., J. D. Goldfine, K. Truitt, J. Imboden, and C. J. Sung. Role of p85 subunit of phosphatidylinositol-3 kinase as an adaptor molecule linking the insulin receptor to insulin receptor substrate 1. Mol. Endocrinol. 9: 435-442, 1995[Abstract/Free Full Text].

19.   Scavo, L. M., J. Serrano, J. Roth, and F. De Pablo. Genes for the insulin receptor and the insulin-like growth factor-I receptor are expressed in the chicken embryo blastoderm and throughout organogenesis. Biochem. Biophys. Res. Commun. 176: 1393-1401, 1991[Medline].

20.   Simon, J. Chicken as a useful species for the comprehension of insulin action. Crit. Rev. Poult. Biol. 2: 121-148, 1989.

21.   Simon, J., and D. LeRoith. Insulin receptors of chicken liver and brain. Characterization of alpha - and beta -subunit properties. Eur. J. Biochem. 158: 125-132, 1986[Medline].

22.   Simon, J., R. W. Rosebrough, J. P. McMurtry, N. C. Steele, J. Roth, M. Adamo, and D. LeRoith. Fasting and refeeding alter the insulin receptor tyrosine kinase in chicken liver but fail to affect brain insulin receptors. J. Biol. Chem. 261: 17081-17088, 1986[Abstract/Free Full Text].

23.   Simon, J., and M. Taouis. The insulin receptor in chicken tissues. In: Avian Endocrinology, edited by P. J. Sharp. Bristol, UK: Journal of Endocrinology, 1993, p. 177-188.

24.   Sugimoto, S., T. J. Wandless, S. E. Shoelson, B. G. Neel, and C. T. Walsh. Activation of the SH2-containing protein tyrosine phosphatase, SH-PTP2, by phosphotyrosine containing peptides derived from insulin receptor substrate-1. J. Biol. Chem. 269: 13614-13622, 1994[Abstract/Free Full Text].

25.   Sun, X. J., M. Milralpeix, M. G. Myers, E. M. Glasheen, J. M. Backer, C. R. Kahn, and M. F. White. Expression and function of IRS-1 in insulin signal transmission. J. Biol. Chem. 267: 22662-22672, 1992[Abstract/Free Full Text].

26.   Sun, X. J., J. P. Rothenberg, C. R. Kahn, J. M Backer, E. Araki, P. A. Wilden, D. A. Cahill, B. J. Goldstein, and M. F. White. Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature 352: 73-77, 1991[Medline].

27.   Taouis, M., M. Derouet, J. P. Caffin, A. Chavanieu, and J. Simon. Insulin receptor and insulin sensitivity in a chicken hepatoma cell line. Mol. Cell. Endocrinol. 96: 113-123, 1993[Medline].

28.   Taouis, M., M. Derouet, B. Chevalier, and J. Simon. Corticosterone effect on insulin receptor number and kinase activity in chicken muscle and liver. Gen. Comp. Endocrinol. 89: 167-175, 1993[Medline].

29.   Taouis, M., R. Levy-Toledano, P. Roach, S. I. Taylor, and P. Gorden. Structural basis by which a recessive mutation in the alpha -subunit of the insulin receptor affects insulin binding. J. Biol. Chem. 269: 14912-14918, 1994[Abstract/Free Full Text].

30.   Taouis, M., S. I. Taylor, and M. Reitman. Cloning of the chicken insulin receptor substrate-1 gene. Gene 178: 51-55, 1996[Medline].

31.   Ullrich, A., J. R. Bell, E. Y Chen, R. Herrera, L. M. Petruzelli, T. J. Dull, A. Gray, L. Coussens, Y. C. Liao, H. Tsubokowa, A. Masur, P. H. Seeburg, C. Grunfeld, O. M. Rosen, and J. Ramachandran. Human insulin receptor and its relationship to the tyrosine kinase family of oncogenes. Nature 313: 756-761, 1985[Medline].


AJP Endocrinol Metab 274(2):E309-E316
0193-1849/98 $5.00 Copyright © 1998 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
I. Seiliez, J.-C. Gabillard, S. Skiba-Cassy, D. Garcia-Serrana, J. Gutierrez, S. Kaushik, S. Panserat, and S. Tesseraud
An in vivo and in vitro assessment of TOR signaling cascade in rainbow trout (Oncorhynchus mykiss)
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2008; 295(1): R329 - R335.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
K. Bigot, M. Taouis, and S. Tesseraud
Refeeding and Insulin Regulate S6K1 Activity in Chicken Skeletal Muscles
J. Nutr., February 1, 2003; 133(2): 369 - 373.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. M. Fernandez, J. K. Kim, S. Yakar, J. Dupont, C. Hernandez-Sanchez, A. L. Castle, J. Filmore, G. I. Shulman, and D. Le Roith
Functional inactivation of the IGF-I and insulin receptors in skeletal muscle causes type 2 diabetes
Genes & Dev., August 1, 2001; 15(15): 1926 - 1934.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
Z. Fu, T. Noguchi, and H. Kato
Vitamin A Deficiency Reduces Insulin-Like Growth Factor (IGF)-I Gene Expression and Increases IGF-I Receptor and Insulin Receptor Gene Expression in Tissues of Japanese Quail (Coturnix coturnix japonica)
J. Nutr., April 1, 2001; 131(4): 1189 - 1194.
[Abstract] [Full Text]


Home page
J. Nutr.Home page
M. A. Yaman, K. Kita, and J.-I. Okumura
Various Macronutrient Intakes Additively Stimulate Protein Synthesis in Liver and Muscle of Food-Deprived Chicks
J. Nutr., January 1, 2000; 130(1): 70 - 76.
[Abstract] [Full Text]


Home page
J. Nutr.Home page
J. Dupont, J. Chen, M. Derouet, J. Simon, B. Leclercq, and M. Taouis
Metabolic Differences between Genetically Lean and Fat Chickens Are Partly Attributed to the Alteration of Insulin Signaling in Liver
J. Nutr., November 1, 1999; 129(11): 1937 - 1944.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dupont, J.
Right arrow Articles by Taouis, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dupont, J.
Right arrow Articles by Taouis, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online