AJP - Endo Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Endocrinol Metab 273: E1140-E1148, 1997;
0193-1849/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Santy, L. C.
Right arrow Articles by Guidotti, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Santy, L. C.
Right arrow Articles by Guidotti, G.
Vol. 273, Issue 6, E1140-E1148, December 1997

Expression of a single gene produces both forms of skeletal muscle cyclic nucleotide-gated channels

Lorraine C. Santy and Guido Guidotti

Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts 02138

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cyclic nucleotide-gated cation channels in skeletal muscle are responsible for insulin-activated sodium entry into this tissue (J. E. M. McGeoch and G. Guidotti. J. Biol. Chem. 267: 832-841, 1992). These channels have previously been isolated from rabbit skeletal muscle by 8-bromoguanosine 3',5'-cyclic monophosphate (8-BrcGMP) affinity chromatography, which separates them into two populations differing in nucleotide affinity [L. C. Santy and G. Guidotti. Am. J. Physiol. 271 (Endocrinol. Metab. 34): E1051-E1060, 1996]. In this study, a polymerase chain reaction approach was used to identify skeletal muscle cyclic nucleotide-gated channel cDNAs. Rabbit skeletal muscle expresses the same cyclic nucleotide-gated channel as rabbit aorta (M. Biel, W. Altenhofen, R. Hullin, J. Ludwig, M. Freichel, V. Flockerzi, N. Dascal, U. B. Kaupp, and F. Hofmann. FEBS Lett. 329: 134-138, 1993). The entire cDNA for this gene was cloned from rabbit skeletal muscle and an antiserum to this protein produced. Expression of this cDNA produces a 63-kDa protein with cyclic nucleotide-gated channel activity. A similarly sized immunoreactive protein is present in sarcolemma. Purification of the expressed channels reveals that this single gene produces both native skeletal muscle channel populations.

insulin; sodium channel

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

CYCLIC NUCLEOTIDE-GATED (CNG) channels were first identified in rod outer segments, where they are responsible for the dark current (9). It was subsequently shown that similar channels are also present in olfactory receptor cilia (25). In both of these tissues, the CNG channels are involved in generating an electrical signal in response to sensory stimuli (18). Purification of the CNG channel from rod outer segments was followed by the cloning of the CNG channel gene (4, 19). Homologous genes comprising a large family have been cloned from olfactory receptors, retinal cones, and a variety of nonsensory tissues (6, 7, 20). The CNG channel family members contain a putative cyclic nucleotide binding domain in their COOH terminal end and have homology to the voltage-gated cation channel family (16, 19, 30).

Although the CNG channels in photoreceptor and olfactory receptor cells have a clearly defined physiological role, the role of CNG channels expressed in most nonsensory tissues is less clear. Because CNG channels conduct Ca2+, one possible function of these channels may be to increase internal calcium levels in response to second messengers (10, 18). For example, a CNG channel may mediate sperm chemotaxis, which depends upon activation of a membrane- bound guanylate cyclase and entry of extracellular Ca2+ (12). The gene encoding the cone CNG channel is also expressed in the testis, and sperm membranes have been shown to contain this protein, suggesting that this channel may connect guanosine 3',5'-cyclic monophosphate (cGMP) to Ca2+ entry (10, 29). Many other nonsensory tissues have been shown to express CNG channel genes. However, investigation of physiological roles or expression of the proteins in most of these tissues has not been undertaken (10).

A physiological role for CNG channels has been studied in skeletal muscle. In this tissue, CNG channels seem to be responsible for insulin-activated sodium entry (22, 23). Release of insulin into the blood promotes uptake of potassium into skeletal muscle and adipocytes by increasing the activity of the alpha 2 isoform of the Na-K-ATPase (3, 21, 27). Uptake of potassium from the blood into skeletal muscle reflects the ability of this tissue to act as a potassium reservoir for the rest of the body (2). To prevent depletion of internal sodium by the activated Na-K-ATPase, insulin also increases sodium entry into skeletal muscle (3, 15). This constant replenishment of internal sodium allows the increased Na-K-ATPase activity to be maintained for upwards of an hour (3, 23, 27).

An insulin-sensitive cation channel has been identified in rat skeletal muscle by patch clamping (22). This channel is activated by the combination of insulin and GTP or by cGMP alone, suggesting that it is a member of the CNG channel family. Similar to other members of the CNG channel family, this channel is fairly nonselective for monovalent and divalent cations and displays a flickering block by calcium (22, 30). An inhibitor of the skeletal muscle CNG channel, µ-conotoxin GIIIB, can block insulin-activated sodium entry into intact skeletal muscle (22, 23). Two forms of CNG channel activity have been isolated from rabbit skeletal muscle using 8-bromoguanosine 3',5'-cyclic monophosphate (8-BrcGMP) affinity chromatography and reconstituted into liposomes (28). These CNG channel forms differ in their activation by cyclic nucleotides. One form has a half-maximal activation constant (K1/2) for cGMP of 5.79 × 10-7 M and a Hill coefficient of 3.63, whereas the other form has a lower affinity with a K1/2 of 1.93 × 10-5 M and a Hill coefficient of 1.16 (28). The two forms of CNG channel may be the products of different CNG channel genes, the consequence of differential splicing of a single gene, or the result of modulation of a single protein. In understanding insulin-activated sodium entry via a CNG channel, it will be important to know which of these possibilities is responsible for the two forms present in skeletal muscle.

In this study, polymerase chain reaction (PCR) has been used to identify and clone the rabbit skeletal muscle CNG channel cDNA. This cDNA is identical to one previously cloned from rabbit aorta (1). An antiserum, anti-rabbit-cyclic-nucleotide-gated channel 3-1 (alpha rCNG3-1), was raised against the COOH-terminal 145 amino acids of the rabbit skeletal muscle CNG protein. Expression of this gene in tissue culture cells leads to the production of a 63-kDa protein that reacts with the alpha rCNG3-1 antiserum. A protein of the same size present in rabbit skeletal muscle sarcolemma also reacts with this antiserum. Expression of the skeletal muscle CNG channel cDNA in tissue culture cells produces CNG channel activity that is most similar to the low cGMP affinity form of the native skeletal muscle channel. This CNG channel activity is inhibited by µ-conotoxin GIIIB, which has previously been shown to inhibit the native skeletal muscle CNG channel and to inhibit insulin-activated sodium entry into this tissue (22). Isolation of the expressed CNG channels with 8-BrcGMP affinity chromatography reveals two forms of CNG channels that resemble the native skeletal muscle channels. This result suggests that the single CNG channel gene cloned from skeletal muscle is responsible for both forms of channel observed in this tissue and that the two forms may arise by differential modulation of a single CNG channel protein.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Materials. Restriction enzymes and other enzymes for molecular biology were from New England Biolabs (Beverly, MA). Glutathione-Sepharose, thrombin, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), µ-conotoxin GIIIB, and protease inhibitors were purchased from Sigma (St. Louis, MO). All reagents for tissue culture were purchased from GIBCO-BRL (Grand Island, NY). HEK 293T cells, which stably express SV40 large T, were obtained from the laboratory of Dr. Ernest Peralta (Harvard University, Cambridge, MA). Lipids were purchased from Avanti Polar Lipids (Alabaster, AL). Primers were ordered from Genemed Biotechnologies (South San Francisco, CA).

RNA isolation and cDNA production. Total RNA was isolated from rabbit tissues using acid guanidinium thiocyanate phenol extraction (26). mRNA was isolated from the total RNA using the PolyATtract mRNA isolation system (Promega, Madison, WI) or the polyA Spin mRNA isolation kit (New England Biolabs) according to the manufacturer's instructions. The mRNA was transcribed into first strand cDNA using oligo(dT), random 9-mer primers, and Stratascript Reverse Transcriptase (Stratagene, La Jolla, CA) according to the manufacturer's protocol.

PCR. Primers were designed to correspond to conserved regions of the cyclic nucleotide binding domain of CNG channels or to the published sequence of the rabbit aorta CNG channel gene (1). All primers, except 955, contained restriction enzyme sites at their 5'-end (DCNGF1 and DCNGF2: EcoR I; all other primers: BamH I). Primer sequences are given below. Degenerate positions are given in parentheses and I stands for inosine.
 DCNFG1: CGGAATTCTIGGIA(G/A)(GA)
GA(G/A)ATGTA(C/T)AT 
 DCNGF2: CGGAATTCTIGGICGIGA
(G/A)ATGTA(C/T)AT 
 DCNGR: CGGGATCCTTIGCIGTIC(T/G)
IC(T/G)(A/G)TTICC 
 DCNG51: CGGGATCCGNATGTT(C/T)GA(A/G)TT
(C/T)TT(C/T)(G/C)A 
 3128B: CGGGATCCGGCGAGATTAGCATCCTTAA
 RACNG32: CGGGATCCTGCAGATAGAGTCCTTCAGA
 RACNG599: CGGGATCCTGTTTCTGGAGGCCAGGAAT
 5128: CGGGATCCTTAAGGATGCTAATCTCGCC
 955: AGCAGGGGCTGCTAGTGA
PCR reactions used cDNA as template for amplification with the above primers. Generally, 35 cycles of PCR were run for each reaction. Reactions contained 2.5 units of AmpliTaq (Perkin-Elmer, Foster City, CA) and 0.0025 units Pfu (Stratagene) polymerases. Reactions to identify the gene (Fig. 1A) were annealed at 50°C and had 2 min of extension at 72°C. Reactions to isolate the gene (Fig. 1C) were annealed at 57°C and had 5 min extension at 72°C. Aliquots of this primary amplification were used as template and reamplified using the same primers and conditions to obtain enough DNA for cloning. PCR reactions to determine tissue expression (Fig. 2) had an annealing temperature of 55°C and 2 min extension at 72°C. Reaction products were purified with the QIAquick PCR purification kit (Qiagen, Chatsworth, CA). Reaction products were then digested with the restriction enzymes whose sites were present at the 5'-end of the primers, separated by agarose gel electrophoresis, isolated with the Geneclean or MERmaid DNA isolation kits (Bio101), and ligated into pGEM3zf- (Promega).


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 1.   Polymerase chain reaction (PCR) identification and cloning of the rabbit skeletal muscle cyclic nucleotide-gated (CNG) channel gene. A: PCR amplification of skeletal muscle CNG gene, using mRNA (0.35 µg) or cDNA (made from 0.25 µg mRNA) as template with degenerate primers DCNGF1, DCNGF2, and DCNGR. These primers correspond to the amino acid sequences (I/V)G(R/K)EMYI and GNRRTAN, which are conserved in the cyclic nucleotide binding domains of all known CNG channels. B: sequence alignment of the skeletal muscle CNG gene. Skeletal muscle PCR product was cloned and sequenced. Analysis of the sequence revealed that it was identical to the previously cloned rabbit aorta CNG channel gene (1). C: cloning of the entire skeletal muscle CNG channel gene by PCR from rabbit skeletal muscle cDNA with primers based on the published sequence of the rabbit aorta CNG channel. Lane 1: 3'-end of the CNG channel gene amplified with primers DCNG51 and RACNG32 (aorta sequence bases 1120 to 2669). Lane 2: 5'-end of the gene amplified with primers RACNG599 and 5128 (bases 99 to 1933).


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 2.   Tissue expression of skeletal muscle CNG channel gene. Rabbit mRNA (5 µg) from the indicated tissues was transcribed into cDNA, and one-fifth of the cDNA was used as template for PCR with primers 955 and 5128 (bases 955 to 1933, sequences described in MATERIALS AND METHODS). Positive control contains the cloned skeletal muscle CNG channel gene as template, whereas negative control contains no template.

DNA sequencing analysis and alignment. PCR products were sequenced after cloning into pGEM. Sequencing was carried out using T7 and SP6 primers and the Sequenase DNA sequencing kit (United States Biochemical, Cleveland, OH). DNA analysis and alignment was done using the Genetics Computer Group sequence analysis software package (Genetics Computer Group, Madison, WI).

Glutathione S-transferase fusion protein production, purification, and antibody production. The 3'-end of the rabbit skeletal muscle CNG channel gene was amplified by PCR using primers 3128B and RACNG32 with an annealing temperature of 55°C and 2 min of extension at 72°C as described above. A portion of this DNA from base 1914 (published aorta sequence numbering) to the EcoR I site at base 2439 was excised from pGEM and was cloned in frame into the vector pGEX-2T (Pharmacia, Piscataway, NJ). This encoded a fusion of glutathione S-transferase (GST) and the COOH-terminal 145 amino acids of the rabbit aorta/muscle channel. This construct was expressed in Escherichia coli BL21. The bacteria were lysed, and the fusion protein was purified on glutathione-Sepharose using the procedure of Frangioni and Neel (11). The CNG channel peptide was eluted from the resin with glutathione or by thrombin digestion (8 U/1 ml resin). The purified, thrombin-eluted peptide was then used for commercial production of polyclonal antiserum alpha rCNG3-1 in guinea pigs (Cocalico Biologicals, Reamstown, PA).

Assembly of the entire gene and expression vector production. Partial digestion with EcoR I and digestion with BamH I were used to isolate complementary and nonoverlapping 5' and 3' pieces of the CNG gene from the cloned skeletal muscle PCR products. The complete coding sequence of the skeletal muscle CNG channel was assembled in the BamH I site of pGEM by joining these fragments at the EcoR I site at position 1506 (aorta sequence numbering). The sequence of the assembled coding region was determined by sequencing small restriction fragments of this gene.

The vector pcDNA-rCNG, which uses a cytomegalovirus promoter to drive high-level transcription in mammalian cells, was produced by inserting the skeletal muscle CNG coding sequence into pcDNA3 (Invitrogen, San Diego, CA). Digestion of the assembled muscle CNG gene with Eco47 III and BamH I was used to isolate the region from bases 138 to 2669. This fragment was ligated into pcDNA3, which had been digested with Kpn I, blunted, and then digested with BamH I.

Cell culture and transfection. HEK 293T cells were grown in a humidified incubator with 5% CO2 at 37°C in Dulbecco's modified Eagle's medium supplemented with penicillin, streptomycin, glutamine, and 10% fetal bovine serum. DNA for transfection was isolated with the Qiagen plasmid MAXI kit (Qiagen). Transfections were performed with the Lipofectamine reagent (GIBCO-BRL) according to manufacture's instructions. Cells were harvested 2-3 days posttransfection.

Membrane isolation. Crude membranes were isolated from HEK 293T cells using the procedure of Coppi and Guidotti (5). N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)-buffered saline [10 mM HEPES-tris(hydroxymethyl)aminomethane (Tris), pH 7.4, 140 mM NaCl, and 5 mM KCl] was used in the place of phosphate-buffered saline. The crude membranes were resuspended in hypotonic lysis buffer containing 10 mM HEPES-Tris, pH 7.4, 50 mM sucrose, 2.5 µg/ml aprotinin, and 1.0 µg/ml each of pepstatin A, chymostatin, and leupeptin. For isolation of enriched plasma membranes, this membrane suspension was loaded onto a sucrose step gradient containing two steps of 15 and 30% sucrose in 10 mM HEPES-Tris, pH 7.4. The gradient was centrifuged at 200,000 g at 4°C for 2 h. Enriched plasma membranes were isolated from the 15:30% sucrose interface. Membranes were diluted with lysis buffer and were pelleted by centrifugation at 100,000 g at 4°C for 30 min. The membrane pellets were subsequently resuspended in lysis buffer by homogenization, frozen in a dry ice-acetone bath, and stored at -70°C.

Sarcolemma was isolated as described previously (28). These membranes were washed by diluting the membranes two times in 1 M KCl and 10 mM ethylene glycol-bis(beta -aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), pH 7.4, and pelleting the membranes at 100,000 g for 30 min at 4°C. The membrane pellet was resuspended in lysis buffer by homogenization. Protein concentration was determined on membranes solubilized in 1% sodium dodecyl sulfate (SDS) with the Bio-Rad DC protein reagent (Bio-Rad, Hercules, CA).

SDS-polyacrylamide gel electrophoresis and immunoblotting. Membranes were solubilized in reducing sample buffer (2% SDS, 65 mM Tris, pH 6.8, 5% beta -mercaptoethanol) and were separated by SDS-polyacrylamide gel electrophoresis (PAGE). Column fractions were extracted with ether to remove lipid and were precipitated with 6% trichloroacetic acid. The pellets were washed with acetone and were resuspended in sample buffer before SDS-PAGE. Proteins were transferred to nitrocellulose and were probed with alpha rCNG3-1 antiserum. Blots were probed with rabbit anti-guinea pig immunoglobulin G-horseradish peroxidase (HRP) antiserum (Sigma) or with protein A-HRP (Calbiochem, La Jolla, CA) and were developed with the SuperSignal chemiluminescent substrate for Western Blotting (Pierce, Rockford, IL) according to the manufacturer's instructions.

8-BrcGMP affinity chromatography and patch clamping. Membranes prepared from HEK cells were solubilized with CHAPS, purified by 8-BrcGMP affinity chromatography, reconstituted, and prepared for patch clamping as described previously (28) with the following exceptions. When preparing patch-clamp samples from unsolubilized HEK membranes, only 0.1 µg of protein were used per 100 µg of lipid. Patch clamping was performed in the absence of EGTA because its presence tended to destabilize the patches. Inhibition of CNG channel activity by µ-conotoxin GIIIB was tested by obtaining patches and assaying for CNG channel activity with the toxin already present in the pipette. This technique was used because, unlike sarcolemma, patches of transfected HEK membranes were not stable enough to survive addition of the toxin to the pipette after patch formation and demonstration of CNG channel activity.

Patch-clamp data were collected and analyzed with the program IGOR (Wavemetrics, Lake Oswego, OR) as described previously (28). Titrations were normalized to the plateau open current after subtraction of any background current. Titrations were then fit by least squares to the Hill equation
<IT>I</IT> = <IT>I</IT><SUB>max</SUB> <FR><NU>[cGMP]<SUP><IT>n</IT></SUP></NU><DE><IT>K</IT><SUP><IT> n</IT></SUP><SUB>1/2</SUB> + [cGMP]<SUP><IT>n</IT></SUP></DE></FR>
where I is current, Imax is maximum current, [cGMP] is cGMP concentration, and n is the Hill coefficient.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cloning of the rabbit skeletal muscle CNG channel coding sequence. To identify CNG channel genes expressed in rabbit skeletal muscle, we used a PCR approach. The amino acid sequence of the cyclic nucleotide binding domain of known CNG channel genes was aligned, and two well-conserved stretches of this region were identified. Degenerate oligonucleotide primers were designed to correspond to the consensus sequence for these regions. As can be seen in Fig. 1A, these primers amplify a band of the expected size [174 base pairs (bp)] from rabbit skeletal muscle cDNA but not from rabbit skeletal muscle mRNA. This result indicates that a member of the CNG channel family is expressed in rabbit skeletal muscle. The band amplified from rabbit muscle cDNA was cloned and sequenced several times and was shown to be identical to the CNG gene previously cloned from rabbit aorta (Fig. 1B; see Ref. 1). The published sequence of this aorta gene (1) was therefore used to design primers to clone the entire coding region from skeletal muscle by PCR. All nucleotide and amino acid numbering used in this study is that of the published aorta sequence (1). As shown in Fig. 1C, both the 5' (bases 99 to 1933)- and 3' (bases 1120 to 2669)-ends of the aorta CNG channel gene can be amplified by PCR from skeletal muscle cDNA. These two pieces cover the entire coding region of this gene (bases 153 to 2348) and have an 800-bp overlap. An EcoR I site (position 1506) in this overlapping region was used to join the 5'- and 3'-ends and to produce the entire skeletal muscle CNG channel gene (aorta bases 99 to 2669). The entire skeletal muscle gene was sequenced and is identical to the aorta sequence except for two C to T transitions at positions 389 and 623. These changes do not change the amino acid sequence and probably represent allelic variation (data not shown).

PCR was also used to investigate the tissue distribution of expression of the skeletal muscle gene. As shown in Fig. 2, a portion of this gene can be amplified from skeletal muscle and stomach cDNA. Amplification from stomach may indicate that this gene is expressed in smooth as well as skeletal muscle. There may also be a low level of expression in kidney and brain where faint bands can be seen in Fig. 2. Small amounts of additional bands were amplified from most tissues tested, probably due to nonspecific priming.

Expression of skeletal muscle CNG channel gene. The COOH-terminal 145 amino acids of the skeletal muscle CNG channel were expressed as a GST fusion and purified as described in MATERIALS AND METHODS (data not shown). This purified peptide was used for production of guinea pig antiserum alpha rCNG3-1 (produced by Cocalico Biologicals). As can be seen in Fig. 3A, the preimmune serum does not react with any proteins in the bacteria expressing the fusion protein, whereas the immune serum reacts strongly with the GST-CNG fusion. Only one additional band is visible in the bacterial lysate.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3.   Immunoblotting with alpha rCNG3-1 antiserum against the rabbit skeletal muscle CNG channel COOH-terminus. A: characterization of alpha rCNG3-1 antiserum. Proteins were separated with 7.5% SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to nitrocellulose. Blot was probed with a 1:1,000 dilution of preimmune serum and then washed and reprobed with a 1:5,000 dilution of immune serum. Lane 1: bacterial lysate expressing glutathione S-transferase (GST)-CNG fusion protein; lane 2: purified GST-CNG fusion protein. B: expression of the muscle CNG channel protein. Plasma membranes were separated by 8% SDS-PAGE and were probed with a 1:1,000 dilution of alpha rCNG3-1. Lane 1: untransfected HEK 293T cells (10 µg); lane 2: HEK 293T transfected with pcDNA-rCNG (10 µg); lane 3: rabbit sarcolemma (500 µg). C: sarcolemma (375 µg) was blotted as in B and was probed with preimmune serum.

The entire skeletal muscle CNG channel was expressed in tissue culture cells by transient transfection. As can be seen in Fig. 3B, expression of the skeletal muscle CNG channel gene leads to production of a 63-kDa protein that reacts with the alpha rCNG3-1 antiserum. Rabbit sarcolemma also contains an immunoreactive protein of the same size, confirming that this protein is expressed in rabbit skeletal muscle (Fig. 3B, lane 3). This band is not seen when rabbit sarcolemma is probed with preimmune serum (Fig. 3C). The dark band in sarcolemma at 42 kDa is the same size as actin and probably represents a nonspecific reaction with this abundant muscle protein.

The properties of the muscle CNG channel were analyzed in HEK 293 cells because these cells have previously been shown not to express any endogenous CNG channel genes (7). As shown in Fig. 4, untransfected HEK cells do not show any increased current with the addition of cGMP. In contrast, membranes from cells transfected with the muscle CNG channel gene do show an increase in current in response to the addition of increasing amounts of cGMP, demonstrating that the product of the skeletal muscle CNG gene does have CNG channel activity. Average currents of representative patches containing untransfected or transfected membranes are shown in Fig. 4A. Figure 4, B and C, shows individual trials of experiments with transfected and untransfected membranes. When these transfected membranes are patched in the presence of µ-conotoxin GIIIB, an inhibitor of the native skeletal muscle CNG channel, this CNG activity is inhibited (Fig. 4A). Fitting of the cyclic nucleotide dependence of the expressed channel with the Hill equation produces a fit with K1/2 for cGMP of 6.15 ± 1.19 × 10-5 M and a Hill coefficient of 1.57 ± 0.53 (Fig. 5). These characteristics are most similar to the low cGMP affinity form of CNG channel seen in rabbit skeletal muscle (28).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4.   Expressed skeletal muscle protein has CNG channel activity. Plasma membranes from transfected and untransfected HEK cells were used for tip-dip patch clamping. Patches with gigaohm seals were picked up on the end of a patch pipette, and current through the patches was tested in the presence of increasing amounts of cGMP in the bath solution. Current through the patches was measured at voltages from -80 to +80 mV in 20-mV increments. Samples with toxin had 2 µM µ-conotoxin GIIIB present in the bath and pipette throughout the experiment. A: average current at +80 mV through representative patches. Data are means + SE of at least 6 trials at each cGMP concentration. Summary of the number of patches with CNG channel activity is shown at bottom. µ-Conotoxin data are from the only patch to show cGMP-dependent current in the presence of toxin. B: individual trials of untransfected plasma membranes. Current traces were recorded in response to voltage pulses ranging from -80 to +80 mV in 20-mV increments. C: individual trials of transfected plasma membranes.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5.   Titration of expressed muscle CNG channel. Plasma membranes of transfected HEK cells were tested by tip-dip patch clamping. Increasing amounts of cGMP were added to the bath, and currents were recorded in response to voltage pulses at +60 and +80 mV. Data are average currents at +80 mV of individual titration experiments normalized to the plateau open current. Each point is mean ± SE of the average current recorded during 5 test voltage pulses. Data from all titration experiments were fit by least squares to the Hill equation. Fit is shown and has a half-maximal activation constant (K1/2) for cGMP of 6.15 ± 1.19 × 10-5 M and a Hill coefficient of 1.57 ± 0.53. Imax, maximum current; [cGMP], cGMP concentration.

Isolation of CNG channels with 8-BrcGMP affinity chromatography. Titrations of HEK membranes expressing the muscle CNG channel gene seem to indicate that all CNG channel activity in these cells is the low cGMP affinity channel form present in skeletal muscle. However, the two forms of skeletal muscle CNG channels only become apparent after solubilization and purification by 8-BrcGMP affinity chromatography (28). Therefore, we used isolation with 8-BrcGMP affinity chromatography to investigate if both channel forms seen in skeletal muscle are present in the transfected HEK cells. As shown in Table 1, when transfected HEK membranes are subjected to 8-BrcGMP affinity chromatography, CNG channel activity elutes from the column in two populations that peak in fraction E2 and in fraction E6 (Table 1). This elution profile is strikingly similar to the pattern seen when rabbit sarcolemma is purified by this method, where CNG channel activity also elutes from the column in fractions E2 and E6 (28).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Elution of expressed CNG channel activity from 8-BrcGMP affinity chromatography

To further compare the two forms of CNG channel isolated from transfected HEK cells with those present in skeletal muscle, we investigated their cGMP dependence. Titration of the peak fractions of CNG channel activity reveals that the HEK fraction E2 has a K1/2 for cGMP of 4.59 ± 0.95 × 10-5 M and a Hill coefficient of 1.37 ± 0.37, whereas HEK fraction E6 has a K1/2 of 5.27 ± 0.66 × 10-7 M and a Hill coefficient of 2.91 ± 0.94 (Fig. 6). These values are very similar to those seen in isolated skeletal muscle CNG channel populations (fraction E2: K1/2 of 1.93 × 10-5 M and a Hill coefficient of 1.16; fraction E6: K1/2 of 5.79 × 10-7 M and a Hill coefficient of 3.63; see Ref. 28). This suggests that the single CNG channel gene cloned from skeletal muscle can produce both of the channel forms that are present in skeletal muscle.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6.   cGMP titrations of isolated channel populations. Proteins from fractions E2 and E6 of the 8-bromoguanosine 3',5'-cyclic monophosphate (8-BrcGMP) column were reconstituted into liposomes and patched by tip-dip patch clamping. Titrations were performed as in Fig. 5. Fit for fraction E2 has K1/2 of 4.59 ± 0.95 × 10-5 M and a Hill coefficient of 1.37 ± 0.37. Fit for fraction E6 has K1/2 of 5.27 ± 0.66 × 10-7 M and a Hill coefficient of 2.91 ± 0.94.

Proteins from the 8-BrcGMP column fractions described in Table 1 were precipitated, separated by SDS-PAGE, and immunoblotted to confirm that the expressed channel protein is present in both isolated CNG channel populations. The CNG channel band in the column fractions is diffuse and streaked (Fig. 7). The rod CNG channel behaves in a similar manner after purification by 8-BrcGMP affinity chromatography (28). As can be seen in Fig. 7, the skeletal muscle CNG channel protein also seems to elute from the 8-BrcGMP column in two populations. The first population is in fractions E1 to E3, whereas the second population is in fractions E5 and E6. This distribution corresponds well to the distribution of the channel activity. The lower band visible in the immunoblot was present in all lanes of this blot, including the lane containing untransfected HEK 293T membranes (Fig. 7). These cells are known not to express any endogenous CNG channel genes (7). Therefore, this lower band is a background band that is unrelated to the skeletal muscle CNG channel.


View larger version (81K):
[in this window]
[in a new window]
 
Fig. 7.   Immunoblot analysis of 8-BrcGMP column fractions. Column fractions were precipitated with trichloroacetic acid and separated by SDS-PAGE as described in MATERIALS AND METHODS. Blot was probed with alpha rCNG3-1 antiserum.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

A gene for a CNG channel, which is identical to that previously cloned from rabbit aorta (1), has been cloned from rabbit skeletal muscle. The only sequence differences between the genes are two single base pair changes that do not change the amino acid sequence of the protein. However, there are differences between the characteristics of the two expressed proteins. The product of the skeletal muscle gene in HEK 293T cells shows a K1/2 for cGMP of 6.15 ± 1.19 × 10-5 M and a Hill coefficient of 1.57 ± 0.53, whereas the product of the aorta gene in oocytes has been reported to have a K1/2 of 1.7 µM and a Hill coefficient of 2.2 (1). This discrepancy may be due to the different expression systems and patch-clamp techniques used to study these genes. The aorta CNG channel was studied using injection of RNA into Xenopus oocytes and inside-out patches excised from the oocytes. The skeletal muscle channel was expressed by transient transfection into HEK cells and was tested using tip-dip patch clamping of HEK plasma membranes.

The rabbit aorta/skeletal muscle gene is most similar to cloned olfactory CNG channel genes (1). The only previous report of the cloning of a CNG channel from skeletal muscle is from Feng et. al. (8), who reported amplifying 200 bp of the rat rod CNG channel gene from skeletal muscle. However, none of our PCR reactions on rabbit skeletal muscle cDNA, including those using degenerate primers that would amplify any known CNG channel gene, showed any evidence for the expression of a rod channel in rabbit skeletal muscle. The primers used by Feng et. al. (8) were specific for the rod CNG channel and therefore would not have detected the expression of an olfactory CNG channel gene in rat muscle. It has also previously been shown that the same nonsensory tissue can express different CNG channel genes, depending on the species (7).

Because the aorta/skeletal muscle CNG channel gene has an open reading frame that encodes 732 amino acids, the expected product is a protein of ~81 kDa. However, the protein detected in transfected tissue culture cells and native skeletal muscle appears by SDS-PAGE to have a mass of 63 kDa. The native rod alpha -subunit also has an apparent mass of 63 kDa on SDS-PAGE, although its gene encodes a protein with a theoretical molecular weight of 79,000 (4, 19). This discrepancy has been attributed to the proteolytic removal of the NH2-terminal 92 amino acids, producing a protein with a theoretical molecular weight of 69,000 (24). A similar cleavage might reduce the size of the skeletal muscle CNG protein. Alternatively, the size difference may be due to the use of a different ATG to initiate translation. The aorta CNG channel start site of translation was assigned to the first in frame ATG, which occurs after a stop codon, at position 153 (1). However, because this codon is not in a perfect consensus sequence for initiation of translation, it has been suggested that the actual start site might be the third ATG, at position 357 (1). The codon at position 357 is in a better consensus sequence and is homologous to the ATG used to initiate translation of the olfactory CNG channel (1). If translation does initiate at position 357 then the theoretical molecular weight of the aorta/skeletal muscle CNG protein would be 73,000, much closer to the observed size of the protein. Any remaining discrepancies in size might be due solely to the difficulty in determining the size of membrane glycoproteins by SDS-PAGE.

Expression of the skeletal muscle CNG channel gene in HEK cells followed by purification with 8-BrcGMP affinity chromatography produces two populations of CNG channel activity that are very similar to the two forms seen after purification of native skeletal muscle CNG channels. Both the native and expressed channels elute from the column in two distinct populations, in fractions E2 and E6. The cyclic nucleotide dependences of the native and expressed populations are also strikingly similar. Fraction E2 from native skeletal muscle has a K1/2 for cGMP of 1.93 × 10-5 M, whereas that from HEK plasma membrane has a K1/2 of 4.59 × 10-5 M. The native and expressed E6 populations are even more similar with K1/2 values of 5.79 × 10-7 M and 5.27 × 10-7 M, respectively (for native values see Ref. 28). Because the expressed channel in HEK membranes appears to be primarily in the low-affinity state, it might be expected that there would be more activity in the E2 fraction than in the E6 fraction after affinity chromatography. This doesn't seem to be the case, probably because the low-affinity form is less tightly bound to the column. Immunoblotting reveals that the expressed skeletal muscle CNG channel protein also elutes from the column in two populations. These results strongly suggest that the two CNG channel forms present in skeletal muscle can be explained by the expression of a single CNG channel gene, the aorta gene.

The finding that expression of one CNG channel gene can produce channels with widely varying cGMP affinities is not entirely unprecedented. It is well documented that the apparent affinity of the CNG channels can be modulated over a wide range. For example, phosphorylation of or nickel binding by the rod channel can change its apparent cGMP affinity by an order of magnitude (13, 14). Additionally, covalent cross-linking of cGMP analogs to the native rod CNG channel has demonstrated two populations of cGMP binding sites with differing cGMP affinities. Cross-linking of cGMP to the rod alpha -subunit expressed in Xenopus oocytes also demonstrated that these channels can have two populations of cGMP binding sites (17). The affinities of the two populations of cGMP binding sites seen by cross-linking, with K1/2 values of 0.42 and 16 µM, are similar to those of isolated skeletal muscle channels (17, 28).

The greatest difference between the native and expressed skeletal muscle CNG channels is the cyclic nucleotide dependence of the channels present in unsolubilized membranes. The CNG channels present in unsolubilized skeletal muscle membranes are most similar to the high cGMP affinity form that is seen after 8-BrcGMP affinity chromatography (28). The expressed CNG channels in HEK plasma membranes, on the other hand, are most similar to the low cGMP affinity form. This finding supports the idea that the low-affinity form of skeletal muscle CNG channel is not an artifact of denaturation during solubilization. Isolation of the CNG channels by 8-BrcGMP affinity chromatography demonstrates that both high and low cGMP affinity channels are present in HEK and skeletal muscle membranes. Perhaps a ubiquitous modification system modulates the affinity of the skeletal muscle channel, and the levels of this modulation are controlled in a tissue-specific manner. Despite these differences, both the native skeletal muscle CNG channel, which is responsible for insulin-activated sodium entry, and the expressed CNG channel can be inhibited by µ-conotoxin GIIIB.

The fact that expression of one CNG channel protein can produce both forms of skeletal muscle CNG channels could have important implications for insulin-activated sodium entry. Insulin may increase sodium entry by increasing cGMP levels and thereby opening the CNG channels. Most of the native skeletal muscle channels may be in the high-affinity form to make them sensitive to small changes in a low level of cGMP. Alternatively, insulin could act to increase the percentage of channels in the high-affinity form, which would increase sodium entry at resting cGMP levels. No matter what the action of insulin, the fact that a single CNG channel protein can produce two CNG channel forms with such disparate cGMP affinity confirms that these channels are not the static sensors of cGMP levels, as was thought when they were first discovered. CNG channels can be modulated by many signals and can produce channels with a large range of affinities. This provides cells expressing these channels with great flexibility in controlling cation entry and in linking this entry to signaling systems.

    ACKNOWLEDGEMENTS

We thank Dr. Maddalena Coppi for reading the manuscript and providing insightful comments.

    FOOTNOTES

This work was supported by National Institutes of Health Grants DK-27626 and GM-07598.

Address for reprint requests: L. C. Santy, Casanova Lab, Pediatric Gastroenterology and Nutrition, Massachusetts General Hospital, 149 13th St., Charlestown, MA 02129.

Received 10 June 1997; accepted in final form 7 August 1997.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Biel, M., W. Altenhofen, R. Hullin, J. Ludwig, M. Freichel, V. Flockerzi, N. Dascal, U. B. Kaupp, and F. Hofmann. Primary structure and functional expression of a cyclic nucleotide-gated channel from rabbit aorta. FEBS Lett. 329: 134-138, 1993[Medline].

2.   Clausen, T. Regulation of active Na+-K+ transport in skeletal muscle. Physiol. Rev. 66: 542-580, 1986[Free Full Text].

3.   Clausen, T., and P. G. Kohn. The effect of insulin on the transport of sodium and potassium in rat soleus muscle. J. Physiol. (Lond.) 265: 19-42, 1977.

4.   Cook, N. J., W. Hanke, and U. B. Kaupp. Identification, purification, and functional reconstitution of the cyclic GMP-dependent channel from rod photoreceptors. Proc. Natl. Acad. Sci. USA 84: 585-589, 1987[Abstract/Free Full Text].

5.   Coppi, M. V., and G. Guidotti. Ubiquitination of Na,K-ATPase alpha 1 and alpha 2 subunits. FEBS Lett. 405: 281-284, 1997[Medline].

6.   Dhallan, R. S., K. W. Yau, K. A. Schrader, and R. R. Reed. Primary structure and functional expression of a cyclic nucleotide-activated channel from olfactory neurons. Nature 347: 184-187, 1990[Medline].

7.   Distler, M., M. Biel, V. Flockerzi, and F. Hofmann. Expression of cyclic nucleotide-gated cation channels in non-sensory tissues and cells. Neuropharmacology 33: 1275-1282, 1994[Medline].

8.   Feng, L., I. Subbaraya, N. Yamamoto, W. Baehr, and N. Kraus-Friedmann. Expression of photoreceptor cyclic nucleotide-gated cation channel alpha subunit (CNGC-alpha) in the liver and skeletal muscle. FEBS Lett. 395: 77-81, 1996[Medline].

9.   Fesenko, E. E., S. S. Kolesnikov, and A. L. Lyubarsky. Induction by cyclic GMP of cationic conductance in plasma membrane of retinal rod outer segment. Nature 313: 310-313, 1985[Medline].

10.   Finn, J. T., M. E. Grunwald, and K. W. Yau. Cyclic nucleotide-gated ion channels: an extended family with diverse functions. Annu. Rev. Physiol. 58: 395-426, 1996[Medline].

11.   Frangioni, J. V., and B. G. Neel. Solubilization and purification of enzymatically active glutathione-S-transferase (pGEX) fusion proteins. Anal. Biochem. 210: 179-187, 1993[Medline].

12.   Garbers, D. L. Molecular basis of fertilization. Annu. Rev. Biochem. 58: 719-742, 1989[Medline].

13.   Gordon, S. E., D. L. Brautigan, and A. L. Zimmerman. Protein phosphatases modulate the apparent agonist affinity of the light-regulated ion channel in retinal rods. Neuron 9: 739-748, 1992[Medline].

14.   Gordon, S. E., and W. N. Zagotta. A histidine residue associated with the gate of the cyclic nucleotide-activated channels in rod photoreceptors. Neuron 14: 177-183, 1995[Medline].

15.   Guidotti, G. Regulation of the (Na,K)-pump. Chemtracts Biochem. Mol. Biol. 1: 447-462, 1990.

16.   Jan, L. Y., and Y. N. Jan. Tracing the roots of ion channels. Cell 69: 715-718, 1992[Medline].

17.   Karpen, J. W., and R. L. Brown. Covalent activation of retinal rod cGMP-gated channels reveals a functional heterogeneity in the ligand binding sites. J. Gen. Physiol. 107: 169-181, 1996[Abstract/Free Full Text].

18.   Kaupp, U. B. Family of cyclic nucleotide gated ion channels. Curr. Opin. Neurobiol. 5: 434-42, 1995[Medline].

19.   Kaupp, U. B., T. Niidome, T. Tanabe, S. Terada, W. Bonigk, W. Stuhmer, N. J. Cook, K. Kangawa, H. Matsuo, T. Hirose, T. Miyata, and S. Numa. Primary structure and functional expression from complementary DNA of the rod photoreceptor cyclic GMP-gated channel. Nature 342: 762-766, 1989[Medline].

20.   Ludwig, J., T. Margalit, E. Eismann, D. Lancet, and U. B. Kaupp. Primary structure of cAMP-gated channel from bovine olfactory epithelium. FEBS Lett. 270: 24-29, 1990[Medline].

21.   Lytton, J., J. C. Lin, and G. Guidotti. Identification of two molecular forms of (Na+,K+)-ATPase in rat adipocytes. Relation to insulin stimulation of the enzyme. J. Biol. Chem. 260: 1177-1184, 1985[Abstract/Free Full Text].

22.   McGeoch, J. E. M., and G. Guidotti. An insulin-stimulated cation channel in skeletal muscle. Inhibition by calcium causes oscillation. J. Biol. Chem. 267: 832-841, 1992[Abstract/Free Full Text].

23.   McGeoch, J. E. M., and A. D. Morielli. An insulin-sensitive cation channel controls [Na+]i via [Ca2+]o-regulated Na+ and Ca2+ entry. Mol. Biol. Cell 5: 485-496, 1994[Abstract].

24.   Molday, R. S., L. L. Molday, A. Dose, I. Clark-Lewis, M. Illing, N. J. Cook, E. Eismann, and U. B. Kaupp. The cGMP-gated channel of the rod photoreceptor cell characterization and orientation of the amino terminus. J. Biol. Chem. 266: 21917-21922, 1991[Abstract/Free Full Text].

25.   Nakamura, T., and G. H. Gold. A cyclic nucleotide-gated conductance in olfactory receptor cilia. Nature 325: 442-444, 1987[Medline].

26.   Puissant, C., and L.-M. Houdebine. An improvement of the single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Biotechniques 8: 148-149, 1990[Medline].

27.   Resh, M. D., R. A. Nemenoff, and G. Guidotti. Insulin stimulation of (Na+,K+)-adenosine triphosphatase-dependent 86Rb+ uptake in rat adipocytes. J. Biol. Chem. 255: 10938-10945, 1980[Abstract/Free Full Text].

28.   Santy, L. C., and G. Guidotti. Reconstitution and characterization of two forms of cyclic nucleotide-gated channels from skeletal muscle. Am. J. Physiol. 271 (Endocrinol. Metab. 34): E1051-E1060, 1996[Abstract/Free Full Text].

29.   Weyand, I., M. Godde, S. Frings, J. Weiner, F. Muller, W. Altenhofen, H. Hatt, and U. B. Kaupp. Cloning and functional expression of a cyclic-nucleotide-gated channel from mammalian sperm. Nature 368: 859-863, 1994[Medline].

30.   Zagotta, W. N., and S. A. Siegelbaum. Structure and function of cyclic nucleotide-gated channels. Annu. Rev. Neurosci. 19: 235-263, 1996[Medline].


AJP Endocrinol Metab 273(6):E1140-E1148
0193-1849/97 $5.00 Copyright © 1997 the American Physiological Society




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Santy, L. C.
Right arrow Articles by Guidotti, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Santy, L. C.
Right arrow Articles by Guidotti, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online